We narrowed to 7,755 results for: RAP
-
Plasmid#187291PurposeExpress pmCherry-IL2-AH-deltaC2DepositorTagsmCherryExpressionMammalianMutationAH-deltaC2PromoterCMVAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pC368: pAAV.CMV-Cas13e-VEGFA sgRNA2
Plasmid#227800PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA2DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pC369: pAAV.CMV-Cas13e-VEGFA sgRNA3
Plasmid#227801PurposePlasmid expressing active Cas13e with VEGFA mRNA targeting gRNA3DepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
Plasmid#223226PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)DepositorInsertNr1d1 (Nr1d1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2046-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223166Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac dual_Human full length _CDK7 (S164D, T170E)_del327-346
Plasmid#217012PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7 (S164D, T170E)_del327-346 (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutation(S164D, T170E)_del327-346Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac dual_Human full length CDK7(W132R, S164D, T170E)
Plasmid#217013PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7(W132R, S164D, T170E) (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutationCDK7(W132R, S164D, T170E)Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-748_HA-GD2-28z_CAR_BATF
Plasmid#207488PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-805_HA-GD2-28z_CAR_BATF-RFP
Plasmid#207492PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-RFP, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-755_HA-GD2-28z_CAR_RFP-JUN
Plasmid#207494PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-JUN, HA-GD2-28z_CAR (JUN Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_MED13L_COL23A1
Plasmid#205849PurposeExpress mEGFP-tagged fusion protein, MED13L_COL23A1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pExp-His-zBasic-RBD-Avi
Plasmid#195000PurposeProduction of SARS-CoV2 receptor binding domain in E. coli with C-terminal Avi-tagDepositorAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only