We narrowed to 11,495 results for: aga
-
Plasmid#189957PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK9c
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK9c_1
Plasmid#185022PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK9c
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTBL436 HEK293site3EQR sgRNA
Plasmid#126445PurposeTo cut the human HEK293 site3 locus for integration.DepositorInsertspacer against human HEK293 site3 with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRExpressionBacterialPromoterS. pyogenes Cas9 native promoterAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi1
Plasmid#59614PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvHA
Plasmid#234991PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti HA scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinsDepositorInsertNA-3C-myc-scfvHA
ExpressionMammalianAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK 3XFlag_4D5-5_CAR-mCherry
Plasmid#247508PurposeExpresses a CAR against HER2 and mCherryDepositorInsertCAR against Her2 and mCherry
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVUTHshGATA1-tTR-KRAB
Plasmid#11650PurposeTet-regulated (Tet-on) lentiviral vector for shGATA1 (hUbiquitin promoter) - 3rd generationDepositorInserthUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (GATA1 Human)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV NA 3C FLAG SA
Plasmid#234993PurposeExpression of transmembrane region of Neuraminidase protein fused to streptavidin protein for displaying on viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN1
Plasmid#52676PurposeshRNA against α-actinin-1 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW-HA-hRb-WT-T373A-S608A-S612A-puro
Plasmid#212674PurposeExpress tagged hRb mutantDepositorAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN4
Plasmid#52679PurposeshRNA against α-actinin-4 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP2A
Plasmid#128349PurposeVector for LUMIER assayDepositorAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneoLuc-PP1A
Plasmid#128348PurposeVector for LUMIER assayDepositorAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
8200 Bicistronic_GFP_ires_hygro
Plasmid#64375PurposeThis a retroviral expression plasmid expressing GFP along with hygro resistance geneDepositorInsertEGFP
UseRetroviralTagsEGFPAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-35kb-DSF-1-6
Plasmid#227487Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-2.4kb-USF
Plasmid#227477Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 2.4kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only