We narrowed to 9,346 results for: tre promoter
-
Plasmid#120510PurposeBarcoded lentiviral vector to express MYC deltaNTD in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaNTD (MYC Human)
UseLentiviralMutationDeletion of amino-terminal domainPromoterEF1aAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaMBI_P2A_Hygro_Barcode
Plasmid#120504PurposeBarcoded lentiviral vector to express MYC deltaMBI in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltab_P2A_Hygro_Barcode
Plasmid#120507PurposeBarcoded lentiviral vector to express MYC deltab in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaMBII_P2A_Hygro_Barcode
Plasmid#120505PurposeBarcoded lentiviral vector to express c-MYC deltaMBII in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertc-MYC deltaMBII (MYC Human)
UseLentiviralMutationDeletion of MYC Box II domainPromoterEF1aAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaLZ_P2A_Hygro_Barcode
Plasmid#120509PurposeBarcoded lentiviral vector to express MYC deltaLZ in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaLZ (MYC Human)
UseLentiviralMutationDeletion of leucine zipper motifPromoterEF1aAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaHLH_P2A_Hygro_Barcode
Plasmid#120508PurposeBarcoded lentiviral vector to express MYC deltaHLH in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC deltaHLH (MYC Human)
UseLentiviralMutationDeletion of helix-loop-helix motifPromoterEF1aAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_v2_Dual_epegRNA_tevopreQ1
Plasmid#187456PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4_v2 optimized epegRNA with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R_v2 epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK Puro GFP-GABARAPL1 G116
Plasmid#123243PurposeExpression vector with PGK promoter for low expression of EGFP-GABARAPL1 G116. For lentivirus production and stable transduction in mammalian cells.DepositorInsertGamma-aminobutyric acid receptor-associated protein-like 1 (GABARAPL1 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationDeleted amino acid 117. Stop codon after G116PromoterPGKAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Thr58Ala_P2A_Hygro_Barcode
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC deltaNLS_P2A_Hygro_Barcode
Plasmid#120506PurposeBarcoded lentiviral vector to express c-MYC deltaNLS in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC H84NLS (MYC Human)
UseLentiviralMutationDeletion of nuclear localization signal sequencePromoterEF1aAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G6_T804N_v1_Dual_epegRNA_tevopreQ1
Plasmid#187458PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 T804N-G6 epegRNA (tevopreQ1) with a user-specified epegRNA. pU6-tevopreq1-GG-acceptor-like plasmidDepositorInsertATP1A1 G6 T804N epegRNA (tevopreQ1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Ser62Ala_P2A_Hygro_Barcode
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowG-AURKA-mTurq2
Plasmid#157768PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL(EF1a-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236279PurposeLentiviral vector that can express hAqp1 with fkbp12 degron in mammalian cells. EF1a promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterEF1aAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL(CMVtight-phi-AQP1-FKBP12DD-IRES-EGFP-WPRE)
Plasmid#236278PurposeLentiviral vector that can express doxycycline-inducible hAqp1 with fkbp12 degron in Tet ON mammalian cells. CMVtight promoter. EGFP marker.DepositorInserthuman aquaporin 1 (AQP1 Human)
UseLentiviralTagsFlag and fkbp12ExpressionMammalianPromoterCMVtightAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA (A11P/V70P)
Plasmid#185717PurposeAAV expression of GFP and human α-Synuclein with A11P and V70P mutations from hSyn promoterDepositorInsertsynuclein, alpha (SNCA Human)
UseAAVMutationChanged Ala 11 to Pro, Val 70 to ProPromoterhSynAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV ShadowY-AURKA-mTurq2
Plasmid#157770PurposeExpression of AuroraA kinase biosensor under CMV promoterDepositorAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPN432
Plasmid#137870PurposeExpression of gRNA a3 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN431
Plasmid#137869PurposeExpression of gRNA a2 targeting TCF4 for CRISPRa; U6 promoterDepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only