We narrowed to 12,039 results for: SHA;
-
Plasmid#163919PurposePGK-driven dTomato expression. Lacks the CBA-promoter controlling EGFP expression.DepositorInsertdtomato
UseLentiviralExpressionMammalianMutationWTAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A CbbL-
Plasmid#162693Purposep1A negative control expressing inactive CbbLS (carbamylated K194M mutation) and PrkDepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialMutationCbbL K194M (inactive rubisco)PromoterPLtet0-1 promoterAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Puro shRNA INPP5E KD2
Plasmid#162005PurposeINPP5E shRNADepositorInsertINPP5E (INPP5E Canis Lupus)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Hygro shRNA INPP4B KD2
Plasmid#162003PurposeINPP4B shRNADepositorInsertINPP4B (INPP4B Canis Lupus)
UseLentiviralAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045B
Plasmid#125004PurposeExpresses gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045D
Plasmid#125006PurposeExpresses gRNAs targeting hedgehog and winglessDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045E
Plasmid#125007PurposeExpresses tRNA-flanked gRNAs targeting hid, eve, and hedgehogDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1045A
Plasmid#125003PurposeExpresses gRNAs targeting hid and eveDepositorAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
iSKetSnFR2
Plasmid#140467PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR2, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR2
TagsHis Tag, HA Tag and Myc tagExpressionBacterialPromoterT7Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
iSKetSnFR1
Plasmid#140466PurposeDevelop a family of genetically encoded fluorescent biosensors for S-ketamine, termed iSKetSnFR1, thus enabling optical subcellular pharmacokinetics for S-Ketamine.DepositorInsertiSKetSnFR1
TagsHis Tag, HA Tag and Myc tagExpressionBacterialPromoterT7Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_mutNSDHL
Plasmid#136428PurposeExpresses NSDHL harboring all currently known mutations within exons 4 and 6 associated with CHILD syndrome.DepositorInserthuman NSDHL with mutations in exon 4 and exon 6 (NSDHL Synthetic, Human)
TagsV5-His tagExpressionMammalianMutationC>T = A105V; G>C = A182P; G>A = R199H; G…PromoterCMVAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo-His-MS2BP-G3BP1-S149A
Plasmid#136009PurposeS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-147
Plasmid#136020PurposeEIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-464
Plasmid#136021PurposeEIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-465-552
Plasmid#136022PurposeEIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-1-464
Plasmid#136023PurposeEIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-148-552
Plasmid#136024PurposeEIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-EIF3B-Unstructured
Plasmid#136026PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-Unstructured-EIF3B
Plasmid#136027PurposeEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only