We narrowed to 10,337 results for: plasmids 101
-
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA2 (5-HT1B Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorInsertd5-HT7R gRNA (5-HT7 Fly)
UseCRISPRTagsExpressionInsectMutationPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO(R285A)-NES
Plasmid#238921PurposeExpression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionInsectMutationPromoterAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 JDM37-GFPnb-mCh
Plasmid#235666PurposeExpresses designed activator of Hsp70 tagged with a GFP nano body and mCherryDepositorInsertJDM37-GFPnb-mCh (PMCH Synthetic, Human)
UseTagsGFP nanobody and mCherryExpressionMammalianMutationPromoterCMVAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXJ-CD274-Nluc
Plasmid#232658PurposeNluc-tagged PD-L1 expresion in mammalian cells; lectin-captured luciferase reporter assayDepositorAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:METTL121B_CE_pISceI
Plasmid#223030PurposeExpress METTL121B gene in mesenchymal lineage of Zebrafish.DepositorInsertMETTL121B
UseExpress the insert(gene) in mesenchymal lineage o…TagsExpressionMutationPromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
rag2:CTDSP2_CE_pISceI
Plasmid#223033PurposeExpress CTDSP2 gene in mesenchymal lineage of Zebrafish.DepositorInsertCTDSP2
UseExpress the insert(gene) in mesenchymal lineage o…TagsExpressionMutationPromoterRag2Available SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKMC356_pTRE-ActivinA_IRES_BFP_WPRE
Plasmid#225355PurposeLentiviral vector for ActivinA and BFP expressionDepositorInsertActvin A and TagBFP (Inhba Synthetic, Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
aTY135_mtk02_pCAG-nfGFPtether_P2A_H2B-IRFP_SV40pA
Plasmid#225350Purposepiggyback backbone for non-fluorescent GFP tether and H2B-IRFP expressionDepositorInsertH2B (H2B Synthetic, Human)
UseTagsmiRFP and non-fluorescent GFP (Y67F)-P2AExpressionMammalianMutationPromoterAvailable SinceDec. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-Actin-Vhh-mNeonGreen-HA (JDW 1225)
Plasmid#224534PurposeA Gateway compatible 3' entry clone containing an Actin nanobody fused to mNeonGreen with a c-terminal HA tagDepositorInsertActin-Vhh-mNeonGreen-HA
UseGateway cloningTagsExpressionMutationPromoterAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF149 shRNA-TRE
Plasmid#225337PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF149 shRNA (Rnf149 Mouse)
UseAAV and RNAiTagsExpressionMammalianMutationPromoterTRE (tetracycline-responsive element)Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCHpr-GCaMP6f
Plasmid#221039PurposeExpresses GCaMP6f under the rat pro-melanin-concentrating hormone promoterDepositorInsertGCaMP6f
UseAAV; Rat targetingTagsExpressionMammalianMutationA317EPromoterRat MCHAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g1
Plasmid#170824PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA1
UsePiggybac transposonTagsExpressionMammalianMutationPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 MMP2 g2
Plasmid#170825PurposePiggyBac Cas13d sgRNA plasmid for MMP2 knockdownDepositorInsertCas13d MMP2 gRNA2
UsePiggybac transposonTagsExpressionMammalianMutationPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only