We narrowed to 7,266 results for: /1000
-
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
TagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK_Hyg_mTurquoise2_Atg4BC74A
Plasmid#161733PurposeDoxycycline-inducible expression of Atg4B(C74A) fused with mTurquoise2 to inhibit autophagyDepositorInsertAtg4B(C74A) (Atg4b Mouse) (Atg4b Mouse)
UseLentiviral; Destinatioin vector for gateway cloni…TagsmTurquoise2ExpressionMammalianMutation220-222 TGC (Cys) is changed to GCA (Ala)Available SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-GFP
Plasmid#66080PurposeThis G protein alpha-q construct contains internal insertions of GFP and the EE epitopeDepositorInsertG protein alpha-q-EE-YFP (Gnaq Mouse)
TagsGFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-CFP
Plasmid#66081PurposeThis G protein alpha-q construct contains internal insertions of CFP and the EE epitopeDepositorInsertG protein alpha-q-EE-CFP (Gnaq Mouse)
TagsCFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7a
Plasmid#160102PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-Mitofusin-1 [N111/24R]
Plasmid#140072PurposeMammalian Expression Plasmid of anti-Mitofusin-1 (Mouse). Derived from hybridoma N111/24.DepositorInsertanti-Mitofusin-1 (Mouse) recombinant mouse monoclonal antibody (Mfn1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-QKI-7 [N183/15R-2b]
Plasmid#219485PurposeMammalian Expression Plasmid of anti-QKI-7 (Human) subclass-switched IgG2b R-mAb. Derived from hybridoma N183/15.DepositorInsertAnti-QKI-7 (Homo sapiens) recombinant mouse monoclonal antibody. (Qki Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7_R505C
Plasmid#160104PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#1/Cre
Plasmid#173635PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7a (closed)
Plasmid#160101PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-1#
Plasmid#234765Purposeknockout Crls1DepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCrls1-2#
Plasmid#234766Purposeknockout CrlsDepositorInsertCrls1 (Crls1 Mouse)
UseLentiviralAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#2/Cre
Plasmid#173636PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7_R505C (closed)
Plasmid#160103PurposeExpresses murine Fbxw7 alpha with the R505C loss-of-function mutation in mammalian cellsDepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFUW-VenusFlag-hCD44
Plasmid#211824PurposeExpress CD44 in mammalian cellsDepositorInsertCD44 (CD44 Human)
UseLentiviralTagsN-Terminal Venus and Flag tagsExpressionMammalianMutationisoform corresponds to UniProt ID P16070-1 with a…Available SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDGB1alpha2_KanR_BastaR_Rb7_GFP
Plasmid#186427Purposeoptimisation of phosphinothricin (Basta) selection in plant cells; combines kanamycin resistance gene (nptII) and Basta resistance gene (bar) with fluorescent marker (eGFP)DepositorInsertsKanR
BastaR
Rb7
eGFP
UseSynthetic Biology; Binary vector for escherichia …ExpressionPlantMutationBsaI and BsmBI sites removedPromoterCaMV 35S and PnosAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-Mitofusin-1 [N111/48R]
Plasmid#225378PurposeMammalian Expression Plasmid of anti-Mitofusin-1 (Mouse) IgG2a R-mAb. Derived from hybridoma N111/48.DepositorInsertAnti-Mitofusin-1 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Mfn1 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only