We narrowed to 16,375 results for: grna
-
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11785
Plasmid#212699PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB10769
Plasmid#212694PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12719
Plasmid#212702PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB12720
Plasmid#212704PurposegRNA targeting to the gene 4HPPD locusDepositorInsertgRNA targeting to the gene 4HPPD locus
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB11787
Plasmid#212695PurposegRNA targeting to the intergradtion site E2DepositorInsertgRNA targeting to the intergradtion site E2
ExpressionYeastAvailable SinceApril 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6637
Plasmid#212696PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8860
Plasmid#212697PurposegRNA targeting to the intergradtion site E3DepositorInsertgRNA targeting to the intergradtion site E3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8856
Plasmid#212701PurposegRNA targeting to the intergradtion site C3DepositorInsertgRNA targeting to the intergradtion site C3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB8866
Plasmid#212703PurposegRNA targeting to the intergradtion site F3DepositorInsertgRNA targeting to the intergradtion site F3
ExpressionYeastAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6630
Plasmid#212700PurposegRNA targeting to the intergradtion site C3DepositorInsertgRNA targeting to the intergradtion site C3
ExpressionYeastAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfB6638
Plasmid#212698PurposegRNA targeting to the intergradtion site E4DepositorInsertgRNA targeting to the intergradtion site E4
ExpressionYeastAvailable SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJA46
Plasmid#59928PurposegRNA for cleavage at rde-1(D801) locus in C elegansDepositorInsertrde-1(D801) gRNA
UseCRISPRAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA45
Plasmid#59927PurposegRNA for cleavage at rde-1(D718) locus in C elegansDepositorInsertrde-1(D718) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus
Plasmid#214678PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two empty sgRNA cloning sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only