We narrowed to 13,356 results for: ache
-
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 L22R
Plasmid#11021DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-Flag-Nter (VE5627)
Plasmid#139773PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an N-ter Flag tag under the pH promoter.DepositorInsertN-terminal Flag tag
TagsFlagPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Cter (VE5629)
Plasmid#139775PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter HA tag under the pH promoter.DepositorInsertC-terminal Hemaglutinine tag
TagsHAPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-6His-Cter (VE5630)
Plasmid#139777PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter6His tag under the pH promoter.DepositorInsertC-terminal 6His tag
Tags6 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-c-Myc-Cter (VE5632)
Plasmid#139778PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter C-Myc tag under the pH promoter.DepositorInsertC-terminal C-Myc tag
Tagsc-MycExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-pH-Flag-Cter (VE5739)
Plasmid#161799PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an C-ter Flag tag under the pH promoter.DepositorInsertC-terminal Flag tag
TagsFlagExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-HA-Nter-P10-mCherry (VE5740)
Plasmid#161800PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a N-ter HA tag under the pH promoter.DepositorInsertN-terminal HA tag
TagsHAExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-PH-3C-10His-Cter (VE5622)
Plasmid#139771PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with a C-ter 10-His tag under the pH promoter.DepositorInsertC-terminal 10-His tag
Tags3C - 10HisPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp15
Plasmid#157721Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp15 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
AB.pCCL.sin.cPPT.U6.miR-10a-Decoy.hPGK.GFP.WPRE
Plasmid#46581DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A
Plasmid#69792PurposePebble isoform A in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble - Drosophila guanine nucleotide exchange factor
UseP element-based puast vector for gal4-regulated e…TagsHA tagExpressionInsectMutationEncodes Pbl (NP_729306.1) lacking last 9 amino ac…Promoterhsp70 promoterAvailable SinceNov. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Gb2-K
Plasmid#25766PurposeEntry vector withTRE promoter driving mouse G beta 2 miR30-based shRNA with GFP coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp7
Plasmid#157689Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp7 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-EF1a-EGFP-TA Bik-IRES-Puromycin
Plasmid#133026PurposeExpresses EGFP-tagged tail anchor sequence of BikDepositorInsertBcl-2-interacting killer (BIK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 1-110PromoterHuman elongation factor 1 alphaAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
Topo_SpCas9.tracr_LbCas12a.DR
Plasmid#155049PurposeTOPO vector for the cloning of _the SpCas9 tracrRNA - LbCas12a Direct Repeat (DR) fragment into the pLCHKO hgRNA vectorDepositorInsertSpCas9 tracrRNA and LbCas12a Direct Repeat (DR)
UseCRISPRAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp15-HF
Plasmid#157722Purposemammalian expression of C-terminally His8-Flag tagged SARS-CoV-2 Nsp15 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
SIN-PGK-Cas9-WPRE
Plasmid#87886PurposeTo produce Lentiviral vector for gene editingDepositorInserthCas9
UseLentiviralTagsnlsMutationHuman codon-optimizedPromotermouse PGKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABE hygro MEN1 T344R
Plasmid#11019DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only