We narrowed to 15,905 results for: grna
-
Plasmid#68710PurposeContains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable sinceSept. 14, 2015AvailabilityIndustry, Academic Institutions, and NonprofitsCited by
-
px-458-sgRNA-scramble
Plasmid#206924PurposePlasmid expressing Cas9, GFP and non-targeting guides for using as a control in CRISPR experimentsDepositorInsertnon-targeting human sgRNA guides
UseCRISPRPromoterU6Available sinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTBL3241 PB-AtoBpegRNA-mCherry
Plasmid#226666PurposePiggyBac cargo vector encoding A to B pegRNA marked with mCherryDepositorInsertAtoB pegRNA
UseCRISPRExpressionMammalianAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #1
Plasmid#202516PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px459-Hira KO sgRNA
Plasmid#186938PurposeHira KO in mouse ES cellsDepositorPublicationAvailable sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ACTB_sgRNA
Plasmid#183885PurposepX459V2.0-HypaCas9 plasmid with ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ANLN_sgRNA
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorAvailable sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM150: pAAV.CMV-Cas13e-VEGFA sgRNA array
Plasmid#203448PurposePlasmid expressing active Cas13e with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pM156: pAAV.CMV-Cas13e (GenScript CO)-VEGFA sgRNA
Plasmid#203452PurposePlasmid expressing active and codon optimised Cas13e with VEGFA gRNADepositorInsertsU6-VEGFA sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-NmeCas9-TLR-MCV1-sgRNA
Plasmid#117407PurposeNmeCas9 sgRNA targeting TLR2.0DepositorInsertNmeCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-CjeCas9-TLR-MCV1-sgRNA
Plasmid#117408PurposeCjeCas9 sgRNA targeting TLR2.0DepositorInsertCjeCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-U6-SauCas9-TLR-MCV1-sgRNA
Plasmid#117409PurposeSauCas9 sgRNA targeting TLR2.0DepositorInsertSauCas9 sgRNA targeting TLR 2.0
UseLentiviralExpressionMammalianPromoterU6Available sinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14112 tyrosinase-targeting sgRNA
Plasmid#239751Purposeguide for tyrosinaseDepositorInsertguide targeting tyrosinase
UseCRISPR; Cell-free system using bacterial extractExpressionBacterialPromoterJ23119Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; EGF_gRNA
Plasmid#199333PurposepDEL158; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 EGF sgRNADepositorInsertszCREST3
Cas9
nrg1 EGF sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_gRNA pAS single_hspCas9
Plasmid#193311PurposeCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)DepositorInsertCas9 from S. pyogenes and U6-pAS single sgRNA (V2.0)
UseCRISPRExpressionMammalianMutationnot applicableAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only