We narrowed to 7,842 results for: chloramphenicol
-
Plasmid#235114PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP3mut3A.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only
-
VN1263 pB2Hws_v28_pLWeakRBS_TIR371_cI-Asf1B+rpoA-IP1_Ddcm_WeaKRBS_TIR51_KanR
Plasmid#235115PurposeQuantitative bacterial two-hybrid (qB2H). Expresses Asf1B and IP1.DepositorInsertsUseSynthetic Biology; Quantitative bacterial two-hyb…TagscI_E34P-rpoAExpressionBacterialPromoterLtetO and lpp+lacUV5Available SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMef2c-AHF-DEST (JDW 476)
Plasmid#242577PurposeGateway destination vector with the murine Mef2c anterior heart field promoter in the backbone.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-HDAC1
Plasmid#109209PurposeEncodes human full-length HDAC1 to be expressed in a baculovirus/insect cell expression systemDepositorInserthuman full-length HDAC1, sequence-optimized for insect cells (HDAC1 Human, Synthetic)
ExpressionInsectPromoterPolyhedrinAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
cBEST4
Plasmid#234660PurposeExpresses cytosine base editor - spCas9n (D10A) fused to APOBEC1 and UGI, Include Golden Gate compatible cassette for sgRNA insertionDepositorInsertsspCas9 cytosine base editor
Golden Gate compatible sgRNA insertion cassette
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3 and tcp830Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AtmiR173aTS-B/c
Plasmid#227964PurposeEntry plasmid with AtmiR173aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
AtmiR173aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-AtmiR173aTS-B/c
Plasmid#227965PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. For expressing syn-tasiRNAs in Arabidopsis thaliana.DepositorInsertsB/c
AtmiR173aTS
ExpressionPlantPromoter35S and NoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-NbmiR482aTS-B/c
Plasmid#227966PurposeEntry plasmid with NbmiR482aTS and a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertsB/c
NbmiR482aTS
PromoterNoneAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆P2
Plasmid#225197PurposeUsed to create a markerless deletion of the E. coli HS P2 phageDepositorInsertP2 phage homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS∆tum
Plasmid#225198PurposeUsed to create a markerless deletion of the E. coli HS tum geneDepositorInserttum homology arms
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag
Plasmid#225193PurposeUsed for adding C-terminal SpyTag to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAX1_HS_gpN:SpyTag003
Plasmid#225194PurposeUsed for adding C-terminal SpyTag003 to the E. coli HS P2 phage major capsid proteinDepositorInsertgpN homology arms and SpyTag003
ExpressionBacterialAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSIP103: pTarget(CyCAST)
Plasmid#200849PurposeTarget plasmid containing CyPSP1 and attachement site for CyCAST.DepositorInsertsPAM for CyCAST + CyPSP1
tRNA-Leu
ExpressionBacterialAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-DEST (JDW 1205)
Plasmid#229821PurposeA PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLAST-DEST (JDW 1009)
Plasmid#229822PurposeA single site gateway compatible destination vector with an upstream GLAST promotor to drive expression in glial cells.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Neo-DEST (JDW 940)
Plasmid#229825PurposeA neo selectable, PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-mKate2
Plasmid#228629PurposeMammalian expression of mKate2 and extra insert, for MuSIC barcode constructionDepositorInsertmKate2
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM-LSSmOrange
Plasmid#228619PurposeMammalian expression of LSSmOrange and extra insert, for MuSIC barcode constructionDepositorInsertLSSmOrange
ExpressionMammalianMutationWe introduced some silent mutations to avoid esse…PromoterCMVAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SBC015869
Plasmid#226281PurposeExpresses MsCAD from trc promoter; expresses BsSfp and SrCAR from a separate trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits