We narrowed to 24,925 results for: crispr
-
Plasmid#186981Purposemammalian expression of Cas7-11 crRNA guideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmature DR guide
ExpressionMammalianAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
Plasmid#164262PurposeVector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.DepositorInsertCodon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
ExpressionBacterialAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSPromoterPgpdAAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
library backbone 3'LTR gRNA and barcode
Plasmid#127397PurposeDigestion by BstXI and BamHI to release the backboneDepositorTypeEmpty backboneUseLentiviralTagsPuro-mCherryAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGria3
Plasmid#124855PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
SGL40C.EFS.E2Crimson
Plasmid#100894PurposeLentiviral gRNA deliveryDepositorInsertE2Crimson
Available sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE1 gRNA #1 (targets Exon 1) (MAPRE1 Human)
ExpressionMammalianPromoterU6Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYZ145
Plasmid#98405PurposeDonor DNA plasmid to introduce leu1 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ149
Plasmid#98407PurposeDonor DNA plasmid to introduce his3 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable sinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS507-pCDest2-noAcr-mTagBFP2-IRES
Plasmid#85748PurposeExpresses mTagBFP2 only; used as a controlDepositorInsertmTagBFP2
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY0312 PhiBT Integrase
Plasmid#179111PurposePhiBT Integrase expression vectorDepositorInsertPhiBT Integrase
UseCRISPRAvailable sinceFeb. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-wtTnsC
Plasmid#234732PurposeWild-type human-codon optimized PseTnsC in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPseTnsC
ExpressionMammalianAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV/Guide-mCherry
Plasmid#170543PurposeExpresses mCherry and contains a cassette for U6 driven sgRNA transcriptionDepositorInsertmCherry
UseCRISPR and LentiviralPromoterEf1-alphaAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_DRS-1 sgRNA / hSpCas9
Plasmid#172841PurposeMammalian expression of the DRS-1 synthetic sgRNA sequence under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDRS-1 sgRNA under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXZX501
Plasmid#169455PurposepRS426-SNR52p-gRNA.MATa_option3-SUP4t; 20-bp gRNA sequence targeting MATa cassetteDepositorInsertgRNA for MATa
ExpressionYeastPromoterSNR52Available sinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
NLS-nCas9-NLS-P2A-EGFP (pRZ70)
Plasmid#123616PurposeCMV promoter expression plasmid for codon-optimized bpNLS-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP (ABEmax control without TadA domains).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNLS-nCas9-NLS-P2A-EGFP
ExpressionMammalianMutationD10A in SpCas9PromoterCMVAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-eNme2-C-BE4max
Plasmid#183679PurposeExpresses eNme2-C-BE4 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertrAPOBEC1-neNme2-C-2xUGI
UseCRISPRExpressionMammalianMutationNme2Cas9 P6S/D16A/E33G/K104T/D152A/F260L/A263T/A3…Available sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only