We narrowed to 13,184 results for: BASE
-
Plasmid#180323Purposemammalian expression of human SEPT9_i3 fused to monomeric AppleDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
HT111_Fsyn_FAS(Cre off)_QuasAr6a_Citrine
Plasmid#178824PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6a_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianPromoterhSynAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-RR(S542R/K607R)-NLS(nucleoplasmin)-3xHA (AAS1081)
Plasmid#114094PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-RR(S542R/K607R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a-RR (S542R/K607R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationS542R and K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-3xHA (AAS826)
Plasmid#114091PurposeCAG promoter expression plasmid for human codon optimized AsCas12a(E174R/S542R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationE174R and S542RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Lyn-PlcR
Plasmid#181830PurposeGenetically encoded FRET-based sensor for monitoring plasma membrane PI(4,5)P2 dynamics in living cells.DepositorInsertLyn-PlcR
TagsECFP, EYFP, and N-terminal targeting sequence fro…ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAD/CMV/V5-DEST-Cdc42-2G
Plasmid#68812PurposeFRET-based biosensor reporting on endogenous Cdc42 activation (for Adenovirus production)DepositorInsertCdc42 activation reporter
UseAdenoviralTagsHis and MycExpressionMammalianPromoterCMVAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic-ME.2/ApoEpromoter
Plasmid#51436PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.2 enhancerDepositorUseLuciferaseExpressionMammalianMutationThe ME.2 enhancer is fused upstream of the ApoE g…Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAWP78-PVCpnf_FLAG-pvc2
Plasmid#198285PurposeContains an external epitope tag on the sheath protein; for immunofluorescence-based binding assaysDepositorInsertPVCpnf_FLAG-pvc2
ExpressionBacterialAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
piGECInano-N1
Plasmid#186190PurposeExpression of small FRET-based near-infrared genetically-encoded calcium indicator in mammalian cellsDepositorInsertiGECInano
ExpressionMammalianPromoterCMVAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
LT3GEP
Plasmid#111172PurposeTet-regulated miR-E (miR-30 variant)-based RNAiDepositorTypeEmpty backboneUseLentiviralTagsEGFPPromoterT3GAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
p15a-AsCas12f-blaZ
Plasmid#171609PurposeAsCas12f1-based E. coli genome editingDepositorInsertAsCas12f1
ExpressionBacterialAvailable SinceDec. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 RFP
Plasmid#163976PurposeMammalian expression vector encoding RFP (for example, to normalize plasmid-based protein expression)DepositorInsertRFP
UseLentiviralExpressionMammalianAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-JeT-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240107PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded JeT PromoterAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 RFP i670
Plasmid#155345PurposeLentiviral expression of humnan CIT shRNA, RFP i670 expression, based on Addgene 12247DepositorInsertCitron (CIT Human)
ExpressionMammalianAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
aCat TL1 (1-907 mTFP1-TSmod-Venus STOP)
Plasmid#101297PurposeFRET-based tension sensor (TS) technology to develop a probe for molecular-level tension across alphaE-catenin.DepositorInsertalpha-Catenin
ExpressionMammalianMutationContains amino acids 1-906 of alpha-CateninAvailable SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP mCherry-ApoB-EGFP
Plasmid#112859PurposePlasmid bearing the editing target of APOBEC1 fused between the mCherry cds and the EGFP one. In presence of APOBEC1, the CAA codon in ApoB is edited to a Stop codon (UAA), leading to loss of EGFPDepositorInsertmCherry-apoB-EGFP
ExpressionMammalianPromoterCMV promoterAvailable SinceOct. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
RT3REVIR
Plasmid#111168PurposeTet-regulated miR-E (miR-30 variant)-based RNAiDepositorTypeEmpty backboneUseRetroviralTagsdsRed and mVenusPromoterT3GAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79621PurposeExpresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionMammalianMutationD10A and H840A for nuclease deficient Cas9PromoterpCMVAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFP59
Plasmid#247215PurposeExpresses superfolder GFP (sfGFP) and a Pepper RNA aptamer (tDF30ppr) from an E. coli sigma70 promoter. Suitable for cell-free expression.DepositorInsertssuperfolder GFP
Dimeric Pepper RNA aptamer (with tRNA and F30 scaffolds)
UseSynthetic Biology; E. coli-based cell-free expres…TagsStreptavidin tagExpressionBacterialMutationTwo mutations were made to the second Pepper unit…PromoterPj23100 (ttgacggctagctcagtcctaggtacagtgctagc)Available SinceMay 29, 2026AvailabilityAcademic Institutions and Nonprofits only