We narrowed to 31,746 results for: son
-
Plasmid#204324PurposeGPCR/G protein BRET biosensorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKB1691-Nluc
ExpressionMammalianAvailable sinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-3G
Plasmid#194464PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order & (GGGGS)3 linker (scFv). GFP-Zeo for selection & monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTACR TH1-p2aGFP
Plasmid#135815PurposeCRISPR based on px330 p2aGFP targeting TH gene near stop codonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTH 1 guide
UseCRISPRTagsp2a Myr-eGFPAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTACR TH2-p2aGFP
Plasmid#135816PurposeCRISPR based on px330 p2aGFP targeting TH gene near stop codonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTH 2 guide
UseCRISPRTagsp2a Myr-eGFPAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOmniBac zz TEV YBBR POT1
Plasmid#185444PurposeExpresses human POT1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cellsDepositorAvailable sinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-C3-10H-SIII
Plasmid#175444PurposeHiFi-compatible destination vector for secreted overexpression of 3C-cleavable, C-terminal 10His-TwinStrep tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTags3C-10His-TwinStrep and BiP Secretion PeptideExpressionInsectPromoterFused Actin-HSP70Available sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenC124S-Puro
Plasmid#135677PurposeConstitutive expression (cMV promoter) of C124S mutant Pten cDNA, Puromycin selectionDepositorAvailable sinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ 3xFLAG-TREX1
Plasmid#164243Purposeretroviral plasmid for 3xFLAG-TREX1DepositorAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
TC1614
Plasmid#164873PurposeCURE-X: C to U RNA Editing, with low off-target effects but also lower efficiencyDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthAPOBEC3A inserted into RfxCas13d (APOBEC3A )
UseCRISPRExpressionMammalianMutationhuman apobec Y132DAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL001
Plasmid#115674PurposeFluorescent reporter for E.coli K12 fliC promoter activityDepositorInsertfliC promoter fused with GFP
TagsGreen fluorescent protein (GFP)ExpressionBacterialPromoterfliC promoterAvailable sinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p1A
Plasmid#162692PurposeExpresses H. neapolitanus CbbLS and S. elongatus Prk. Rescues CCMB1 in M9 glycerol at 10% CO2DepositorInsertH. neapolitanus CbbLS and S. elongatus Prk
TagsN terminal 6x His tag on PRKExpressionBacterialPromoterPLtet0-1 promoterAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKD077
Plasmid#136473PurposeSSB-mTur2 IDL fusion expression plasmidDepositorInsertSSB-mTur2 (ssb E. coli)
TagsmTurquoise2ExpressionBacterialMutationmTurquoise2 inserted between Phe148 and Ser149PromoterT7 promoterAvailable sinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMH-HT_SsCHAD
Plasmid#127783PurposeExpresses SsCHAD in E. coli cellsDepositorInsertSsCHAD (SULM_RS11045 Sulfolobus solfataricus)
Tags6xHis tag + TEV cleavage siteExpressionBacterialAvailable sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_SRY_P2A_Hygro_Barcode
Plasmid#120485PurposeBarcoded lentiviral vector to express SRY in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS956 IBB-GFP-mCherry3E
Plasmid#107859PurposeFlow cytometry-compatible reporter for TDP43 function in splicingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSynthetic splicing reporter (TARDBP Synthetic)
ExpressionMammalianAvailable sinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pIRESneoFLAGhAR
Plasmid#89116PurposeN-terminal FLAG-tagged full-length human androgen receptor in pIRESneo for stable expression, selection using G418 neomycinDepositorAvailable sinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
mTagRFP-T2-Paxillin-22
Plasmid#58042PurposeLocalization: Focal Adhesions, Excitation: 555, Emission: 584DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPaxillin
TagsmTagRFPExpressionMammalianPromoterCMVAvailable sinceJuly 31, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits