We narrowed to 13,763 results for: sequence
-
Plasmid#216377PurposeBaculovirus transfer vector to co-express FLAG-LRP6-His (human sequence, codon-optimized for insect cell expression) and MESD chaperone (human sequence)DepositorInsertLDL receptor related protein 6 (LRP6 Human)
UseBaculovirusTags9xHis and HA signal sequence-FLAG-3C cleavage sit…ExpressionInsectPromoterPolyhedrin (LRP6)/p10 (MESD)Available SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p210 pCMV-CREM
Plasmid#8395PurposeCre with chimeric/β-globin intron within the Cre coding sequenceDepositorInsertCREM
UseCre/LoxExpressionMammalianMutationmodified CrePromoterCMVAvailable SinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLSLGUS
Plasmid#51517PurposepLSL with GUS coding sequence followed by 3 kb of filler sequence Rep is not included on this plasmidDepositorInsertsGUS
3kb filler sequence
UsePlant t-dna plasmidTagsNLS and flagPromotervirion-sense LIR and 2x35SAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-EGFP
Plasmid#196606PurposeDual-Luciferase Reporter vector carrying an EGFP direct sequenceDepositorInsertGFP
ExpressionMammalianAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
C79m
Plasmid#120991PurposeMoClo golden gate assembly CD part for ccdA (Antitoxin to ccdB/C39m. Sequence taken from pMAR7 plasmid sequence). Please see Supplemental Documents for annotated Genbank file.DepositorInsertccdA antitoxin
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl
Plasmid#228409PurposeExpression of NIT-9 in N. crassa at the his-3 locusDepositorInsertNIT-9
UseProtein expression in n. crassaAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Ef1a_FLEX_mAPEX2_P2A_mRuby2
Plasmid#171938PurposeExpresses membrane targeted (palmitoylation) APEX2 and mRuby2 as separate proteinsDepositorInsertApex2, mRuby2
UseAAV and Cre/LoxExpressionMammalianPromoterEf1aAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_FLEX_tau-APEX2
Plasmid#171937PurposeExpresses APEX2 linked to tau for labeling microtubulesDepositorInserttau-APEX2
UseAAV and Cre/LoxExpressionMammalianPromoterhsynAvailable SinceJuly 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry_C1_miR21
Plasmid#65970PurposeExpressed mCherry under the control of miR-21 (miR-21 complementary sequence in 3' UTR)DepositorInsertmiR-21 complementary sequence
ExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Efla_FLEX_APEX2-eGFPf
Plasmid#171939PurposeExpresses a membrane targeted (farnesylation) APEX2-eGFP fusion proteinDepositorInsertAPEX2-eGFPf
UseAAV and Cre/LoxExpressionMammalianPromoterEf1aAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9_without_linker
Plasmid#228411PurposeExpression of NIT-9 without linkage region in N. crassa at the his-3 locusDepositorInsertNIT-9
UseProtein expression in n. crassaMutationdeletion of the linkage regionAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl_reverse
Plasmid#228410PurposeExpression of NIT-9 with reversed domains in N. crassa at the his-3 locusDepositorInsertNIT-9 domains reversed
UseProtein expression in n. crassaMutationdomains reorientedAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSCARS1
Plasmid#174868PurposeContains TEF1p-TEF1in-hGFP-CYCt cassette and wildtype ARS1DepositorInsertARS1
UseSynthetic BiologyExpressionBacterial and YeastAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGrDL_SPb
Plasmid#83205Purposereceives miRNA target sequences for testing using the dual luciferase assay systemDepositorInsertTomato ACTIN promoter
ExpressionPlantPromoterTomato ACTINAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS84 (U6p::GGACAGTCCTGCCGAGGTGG)
Plasmid#193852PurposeEncodes the guide RNA targeting the sequence GGACAGTCCTGCCGAGGTGGDepositorInsertGuide RNA
UseCRISPRExpressionWormPromoterU6Available SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGrDL_SP
Plasmid#83204Purposereceives miRNA target sequences for testing using the dual luciferase assay systemDepositorInsertSalI/PstI cloning sites
ExpressionPlantAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2)_zeo insert c-MYC
Plasmid#164636PurposesgRNA(MS2)_zeo backbone with cloned target sequence for human c-MYC. The insert sequence is: 5-CACCGTTCCCCCACGCCCTCTGCTT-3´ . This sgRNA achieves an upregulation of MYC in combination with dCAS9-VP64DepositorInserttarget sequence for c-Myc activation (MYC Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
p240 pPr-CREM/Ins
Plasmid#8405PurposeAndrogen-inducible expression of Cre, with chimeric/β-globin intron within the Cre coding sequence and chicken globin insulators.DepositorInsertprobasin driven CREM with insulators
UseCre/LoxExpressionMammalianMutationmodified CrePromoterProbasin promoterAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pQE80L TriCatcher-RGDSP-MMP
Plasmid#112633PurposeTwo SpyCatchers linked by an elastin-like polypeptide with an RGDSP integrin-binding site, an MMP-cleavable sequence and a C-terminal SnoopCatcherDepositorInsertTriCatcher-RGDSP-MMP
TagsHis6 and TEV cleavage siteExpressionBacterialMutationcentral matrix metalloproteinase-cleavable sequen…PromoterT5Available SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p236 pPr-CREM
Plasmid#8404PurposeExpression of Cre from tissue-specific, androgen-inducible probasin promoter, with chimeric/β-globin intron within the Cre coding sequence.DepositorInsertprobasin driven CREM
UseCre/LoxExpressionMammalianMutationmodified CrePromoterProbasin promoterAvailable SinceApril 28, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLSLZ
Plasmid#51495PurposepLSL with Zif268:FokI coding sequence followed by approximately 3kb 'filler' sequence, Rep is not included on this plasmidDepositorInsertsZif268:FokI
3kb filler sequence
UsePlant t-dna plasmidTagsSV40 NLSPromotervirion-sense LIR and 2x35SAvailable SinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
p201N 1514
Plasmid#47025PurposeContains soybean miRNA miR1514 recognition sequence to produce siRNAs from 3' target sequences and induce RNA silencingDepositorInsertsgma-miR1514 recognition sequence
nptII selectable marker
UseRNAiPromoterGmUbi and StUbi-3Available SinceAug. 30, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
GB2880
Plasmid#193117PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.6
UseSynthetic BiologyAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3277
Plasmid#193131PurposeA2 Proximal promoter sequence consisting of three times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1abc.4
UseSynthetic BiologyAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2888
Plasmid#193126PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.4
UseSynthetic BiologyAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2886
Plasmid#193124PurposeA2 Proximal promoter sequence consisting of two times the target sequence for the gRNA1 (GB1838) flanked by random sequences.DepositorInsertGB_SynP (A2) G1ab.3
UseSynthetic BiologyAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB2883
Plasmid#193120PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.4
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2882
Plasmid#193119PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.3
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2878
Plasmid#193115PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.1
UseSynthetic BiologyAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2881
Plasmid#193118PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.2
UseSynthetic BiologyAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only