We narrowed to 2,388 results for: control GFP
-
Plasmid#73651PurposeFluorescent reporter for transmembrane protein dimerization positive control.DepositorInsertglycophorin A
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS_sfGFP150K
Plasmid#193313PurposepAS control plasmid for sfGFP expressionDepositorInsertsuper folder GFP
ExpressionMammalianMutation150K in sfGFPPromoterEF1Available SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFP G protein Gamma 3(K68A,K69A,F70A,F71A) in pcDNA3.1
Plasmid#42189DepositorInsertGamma 3(K68A,K69A,F70A,F71A) (Gng3 Mouse)
TagsEGFPExpressionMammalianMutationK68A,K69A,F70A,F71APromoterCMVAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-S37K/A44E (delta-NDP52)
Plasmid#208863PurposeStably express GFP-tagged NAP1 (delta-NDP52) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationS37K/A44E (disrupts NDP52 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-I11S/L12S (delta-FIP200)
Plasmid#208864PurposeStably express GFP-tagged NAP1 (delta-FIP200) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationI11S/L12S (disrupts FIP200 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-FKBP-GFP-NAP1-L226Q/L233Q (delta-TBK1)
Plasmid#208865PurposeStably express GFP-tagged NAP1 (delta-TBK1) for CID induced mitophagyDepositorInsertNAP1 (AZI2 Human)
TagsFKBP-GFPExpressionMammalianMutationL226Q/L233Q (disrupts TBK1 binding)Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogGFP (C44, JBEI-16338)
Plasmid#110144PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-E3-NSs-L*-EGFP-IRES-srIκBα-Smad7-SOCS1
Plasmid#242412PurposeSelf-amplifying RNA (saRNA) construct expresses dsRNA pathway inhibitors (E3, NSs, L*) and inflammatory signaling inhibitors, srIκBα, Smad7, and SOCS1.DepositorInsertsmScarlet3
IRES-E3-NSs-L*-EGFP
IRES-srIκBα-Smad7-SOCS1
UseMouse Targeting; Self-amplifying rnaExpressionMammalianAvailable SinceSept. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV EGFP Puro
Plasmid#236084PurposeLentiviral backbone expressing EGFP, control for empty backbone 236083DepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEF5-FRT-V5-DEST-GFP-Kif26b
Plasmid#102862PurposeExpresses GFP-Kif26b in mammalian cellsDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human 3' HP1a AID GFP PuroR
Plasmid#127906PurposeHDR (donor) Plasmid for Inserting AID-GFP-2A-Puro into the 3' end of the Human HP1a GeneDepositorInsertHP1 (CBX5 Mustard Weed, Human)
UseDonor plasmidTagsGFP, AID, PuroRMutationInserting GFP AID 2A Puro into mouse 3' Hp1aAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MYC-GFP-IRES-mCherry
Plasmid#231232PurposeMYC stability reporter construct (expressing c-myc 2) for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMYC (MYC Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MCRS1-GFP-IRES-mCherry
Plasmid#231231PurposeMCRS1 stability reporter construct for transient expression in mammalian cells. Stability of GFP-fusion protein can be assed by flow cytometry by normalizing to mCherry expression.DepositorInsertMCRS1 (MCRS1 Human)
ExpressionMammalianAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-d2eGFP-cxcr4
Plasmid#21967DepositorTypeEmpty backboneExpressionMammalianAvailable SinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
Sox17::CRY2-GFP
Plasmid#248078PurposeExpression of Sox17-driven CRY2–GFP fusion protein for optogenetic controlDepositorAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMX-Flag-GFP_CBLN3
Plasmid#227950PurposeControl plasmid. Important note: Construct with N-terminally tagged GFP which might mask the signal sequence for proper localization of the proteinDepositorAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only