We narrowed to 25,548 results for: Nov;
-
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-FLAG-mProser1-IRES-Blast
Plasmid#226172PurposeExpresses full length mouse PROSER1 with 2X N-terminal FLAG tagsDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-OsTIR1(WT)
Plasmid#140729PurposeOsTIR1(WT)-P2A-mAID-EGFP-NESDepositorInsertOsTIR1(WT)-P2A-mAID-EGFP-NES
UseAAVExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-HP1α-miRFP670-Cry2WT
Plasmid#122442PurposeExpresses disordered protein HP1α fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertHP1 alpha (CBX5 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianPromoterSFFVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-BTC-ScNeo
Plasmid#209898PurposeTo monitor the status of Betacellulin, the plasmid encodes a recombinant BTC fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-Necl5-ScNeo
Plasmid#209901PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp16
Plasmid#157724Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp16 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
EF1a_KLF4_P2A_Hygro_Barcode
Plasmid#120455PurposeBarcoded lentiviral vector to express KLF4 in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV_iRFP_P2AT2A_mScarlet-I_Myl9
Plasmid#172474PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.DepositorInsertsUseLentiviralTagsmScarlet-IExpressionMammalianPromoterEF1alpha (with UCOE) and none (same transcript as…Available SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human a3 nicotinic receptor subunit EM construct
Plasmid#163960PurposepEZT-BM vector with alpha3 gene after CMV promoter, published EM constructDepositorInsertHuman alpha3 nicotinic acetylcholine receptor subunit EM construct
UseBaculovirus (bacmam) production and mammalian exp…Tagsapocytochrome b(562)RIL (BRIL)ExpressionMammalianMutationAsn348-Ser402 replaced with apocytochrome b(562)R…PromoterCMVAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-Macro-Linker-eGFP
Plasmid#176067PurposeEGFP fused to the C-terminus of a Macrodomain & a hygromycin resistance cassetteDepositorInsertMacro
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBW_0141
Plasmid#102820PurposepVec8 containing Sr45 geneDepositorAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-FHA-Linker-eGFP
Plasmid#176065PurposeEGFP fused to the C-terminus of a FHA domain & a hygromycin resistance cassetteDepositorInsertFHA
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-miRFP670-Cry2WT
Plasmid#122439PurposeExpresses disordered protein BRD4(462-1362) fused with fluorescent protein miRFP670 and optogenetic protein Cry2WTDepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsCry2WT and miRFP670ExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13_GC3opt
Plasmid#157714Purposemammalian expression of untagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertNsp13-HF_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
PCMV-intron myc Rab11 S25N
Plasmid#46786Purposeexpression of S25N Rab11a in mammalian cellsDepositorInsertRAB11A S25N (RAB11A Human)
TagsmycExpressionMammalianMutationS25N dominant negativePromoterCMVAvailable SinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only