We narrowed to 22,939 results for: REP
-
Plasmid#255412Purpose3'UTR from Sorghum bicolor Heat shock 16.9kDa protein for tunable gene expression in monocotsDepositorInsert3SbHSP16.9
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMTK_062-Sbic-3SbHSP70
Plasmid#255413Purpose3'UTR from Sorghum bicolor Heat shock 70kDa protein for tunable gene expression in monocotsDepositorInsert3SbHSP70
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMTK_067-Svir-3SvHSP70
Plasmid#255418Purpose3'UTR from Setaria viridis Heat shock 70kDa protein for tunable gene expression in monocotsDepositorInsert3SvHSP70
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMTK_069-Zmay-3ZmHSP70
Plasmid#255420Purpose3'UTR from Zea mays Heat shock 70kDa protein for tunable gene expression in monocotsDepositorInsert3ZmHSP70
ExpressionPlantAvailable SinceJune 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pREW2[luciferase fragment in pPD129.36/L4440]
Plasmid#253297PurposeIn HT115 host, expresses dsRNA corresponding to a luciferase sequence with no matches in the C. elegans genome. Excellent for negative control bacterially mediated RNAiDepositorInsertluciferase fragment
ExpressionBacterialPromoterTwin T7 promotersAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pOTTC2234 - pAAV Nestin GFP-iCre
Plasmid#228443PurposeAn adeno-associated viral vector to express GFP-iCre fusion protein under the human Nestin 2nd intron enhancer.DepositorInsertGFP-iCre
UseAAVExpressionMammalianAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK ΔCRD-Fc
Plasmid#246706PurposeExpression vector for secreted human RECK lacking the CRD, fused to mouse IgG2a FcDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔaa 343-476, ΔGPI anchor signalPromoterCMVAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-9-RECK ΔCK
Plasmid#246707PurposeExpression vector for human RECK lacking CC domains 1-5, N-terminal 3xFLAG tagDepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-9-RECK ΔCRD
Plasmid#246708PurposeExpression vector for human RECK lacking the CRD, N-terminal 3xFLAG tagDepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sRECK-Fc
Plasmid#246704PurposeExpression vector for a secreted human RECK-mouse IgG2a Fc fusion proteinDepositorInsertRECK (RECK Human)
Tagsmouse IgG2a FcExpressionMammalianMutationΔGPI anchor signalPromoterCMVAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-9-sGpr124
Plasmid#246710PurposeExpression vector for secreted mouse Gpr124 ECD, N-terminal 3xFLAG tagDepositorAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-9-GPR124 ΔECD
Plasmid#246689PurposeExpression vector for human GPR124 lacking the ECD, N-terminal 3xFLAG tagDepositorAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV-9-GPR124 ΔICD
Plasmid#246690PurposeExpression vector for human GPR124 lacking the ICD, N-terminal 3xFLAG tagDepositorAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Igκ SP-sGPR124-Fc
Plasmid#246684PurposeExpression vector for a secreted human GPR124 ECD-mouse IgG2a Fc fusion proteinDepositorAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHD Btl-pYtag(Scarlet) ScarlessDsRed
Plasmid#244937PurposeVector for tagging Breathless (Btl) with Scarlet-based pYtag biosensor. DsRed marker.DepositorInsertmScarlet-tagged pYtag system (3xITAM P2A mScarlet-ZtSH2)
UseEndogenous taggingAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgYME1L1 sg1
Plasmid#244867PurposeKnockout of human YME1L1DepositorAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy FAM136A-HA mutant
Plasmid#244882PurposeIn vitro transcription of mutant human FAM136A downstream of SP6 promoterDepositorInsertFAM136A mutant (FAM136A Human)
UseSynthetic BiologyTagsHAExpressionBacterialMutationGRCh38, chr2:70300842G>APromoterSP6Available SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp High Copy FAM136A-HA WT
Plasmid#244883PurposeIn vitro transcription of wild-type FAM136A downstream of SP6 promoterDepositorAvailable SinceOct. 20, 2025AvailabilityAcademic Institutions and Nonprofits only