We narrowed to 1,600 results for: αGFP
-
Plasmid#163381PurposeSecond generation lentiviral vector to express anti-GFP(LaG17) module in the G-baToN systemDepositorInsertLaG17-VEEGFRtm-BFP (LVB)
UseLentiviralTagsBFPExpressionMammalianPromoterEF1AAvailable SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flp-DOG-NW
Plasmid#75469PurposeFlp recombinase dependent on GFP (Flp-DOG) for rAAV production and expression in mammalian cellsDepositorHas ServiceAAV1InsertFlp-DOG
UseAAV and Synthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET22b Ag43 160N 6H sfGFP-R5 AmpR
Plasmid#225139PurposeRecombinant Ag43 protein fused to silaffin-R5 and sfGFP. pelB as the periplasmic signal. His-tag for purification. TEV enzyme recognition site between Ag43 alpha subunit and the fluorescent protein.DepositorInsertAg43 protein fused to silaffin-R5 and sfGFP
TagsHis tagExpressionBacterialPromoterT7Available SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP(N-glyc)-Tac-TC
Plasmid#162496PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in the N-terminus in mammalian cells, and there is one N-glycosylation site in GFP tag.DepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCellFree_G03 TCF3
Plasmid#67110PurposeStandard for cell-free expression benchmarking.DepositorInsertTCF3 (TCF3 Human)
UseCell-free expressionTagsEGFP and HisMutationTruncated isoformPromoterT7Available SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHNF4A-Enh_Gsta2-IRES2-H2BeGFP
Plasmid#247049PurposeThis plasmid was employed to generate the mouse model used in this study. It contains the human HNF4A gene enhancer linked to the Shh mini-promoter and the Gsta2-IRES2-H2BeGFP. Homologous armDepositorInsertGlutathione S-Transferase Alpha 2 (Gsta2 Mouse)
ExpressionMammalianAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_H0-ABD+
Plasmid#234552PurposeCTNNA1 enhanced-actin-binding domain mutationsDepositorInsertmEGFP:hCTNNA1_H0-ABD+ (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationR666G, A667S, I668G, M669SPromoterCMVAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_DM1-3_WT-ABD
Plasmid#234553PurposeCTNNA1 M-domain deletion mutantDepositorInsertmEGFP:hCTNNA1_DM-domain (CTNNA1 Human)
UseLentiviralTagsmEGFPMutationDeletion of aa 273-635PromoterCMVAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_E307K
Plasmid#234560PurposeCTNNA1 butterfly eye mutantDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-mEGFP-hCTNNA1_R551A
Plasmid#234558PurposeCTNNA1 M2-M3 salt-bridge disrupting mutantDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRB2963
Plasmid#8678DepositorAvailable SinceJune 30, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRS406-PHO5-GFP-CERT PH domain
Plasmid#58725PurposeExpresses GFP-Tagged CERT PH domain in yeastDepositorInsertcollagen, type IV, alpha 3 binding protein PH domain (CERT1 Human)
TagsGFP and MycExpressionYeastPromoterPHO5Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hACE2-hygro
Plasmid#161758PurposeExpresses human ACE2 in mammalian cellsDepositorAvailable SinceNov. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-TC
Plasmid#162492PurposeExpresses partial length Tac (TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its TMD and cysotol…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-mPar6a WT
Plasmid#86148PurposeFLAG tagged mouse Par6 wild type - Binds to aPKC, Par3, Lgl, Cdc42DepositorAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mouse aB crystallin 1.5kb promoter/AcGFP
Plasmid#98104PurposeMouse aB crystallin 1.5kb promoter segment driving GFP expressionDepositorInsertAlpha B-crystallin promoter 1.5 kb fragment, Mus musculus (Cryab Mouse)
UseGfp expressingTagsGFPPromoterAlpha B-crystallin 1.5 kb promoter fragment (-150…Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Venus-Puma-pEGFP-C1
Plasmid#166739PurposeExpress Venus fused to the N-terminus of the Bcl-2 family protein, PumaDepositorAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse aB crystallin 250bp promoter/AcGFP
Plasmid#98102PurposeMouse aB crystallin 250bp promoter segment driving GFP expressionDepositorInsertAlpha B-crystallin promoter 250 bp fragment, Mus musculus (Cryab Mouse)
UseGfp expressingTagsGFPPromoterAlpha B-crystallin promoter 250 bp fragment (-259…Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only