We narrowed to 15,941 results for: nans
-
Plasmid#186767PurposeAn mRNA production vector encoding planarian codon-optimized nanoluciferase (sNluc2) containing a premature stop codon.DepositorInsertNanoluciferase
MutationPremature stop codon at residue 16PromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTL464
Plasmid#69881Purposea dCirl transcriptional reporter allele that contains an optimized gal4.2::p65 cassette at the start codon of the genomic dCirl ORFDepositorInsertCIRL (Cirl Fly)
UsePhic31-integration vectorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-scrambled
Plasmid#183455PurposeThis control vector contains a scrambled version of the targeting sequence used in the pFUGW-shRIIα constructDepositorInsertscrambled sgRNA
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
RWDD2B_pLENTI-CAG-IRES-GFP
Plasmid#177001PurposeMammalian lentiviral expression vector encoding RWDD2BDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
WDR4_pcDNA6.2/EmGFP-Bsd
Plasmid#176984PurposeMammalian expression vector encoding WDR4 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RWDD2B_pcDNA6.2/EmGFP-Bsd
Plasmid#176956PurposeMammalian expression vector encoding RWDD2B and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCBP3_pcDNA6.2/EmGFP-Bsd
Plasmid#176958PurposeMammalian expression vector encoding PCBP3 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
POFUT2_pcDNA6.2/EmGFP-Bsd
Plasmid#176960PurposeMammalian expression vector encoding POFUT2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pExpreS2-1-CR-PA
Plasmid#175445PurposeHiFi-compatible destination vector for secreted overexpression of thrombin-cleavable, C-terminal Protein A tagged proteins with ExpreS2 PlatformDepositorTypeEmpty backboneTagsBiP Secretion Peptide and Thrombin-Protein AExpressionInsectPromoterFused Actin-HSP70Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.H2B.RFP
Plasmid#170370PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-HE-bPAC(R278A)-Myc-eYFP
Plasmid#165488PurposeXenopus oocyte expression of soluble photoactivatable adenylyl cyclase derived from bPAC with reduced dark activityDepositorInsertbPAC(R278A)-Myc-eYFP
UseCdna expression, xenopus oocyteTagsEYFP and MycExpressionBacterialPromoterT7Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.H2B.RFP
Plasmid#170372PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PdnaK-IR2-IR2 GFP pZa
Plasmid#170083PurposeGFP expression under the control of E. coli dnaK promoter engineered with double IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2-IR2Available SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585_L139*
Plasmid#174400PurposeS. Typhimurium gene stm2585 (sarA/steE) truncated after 139th amino acid, which removes the stretch homologous to gp130DepositorInsertsarA
TagsEGFP and FlagExpressionMammalianMutationL139* (Truncation after 139th amino acid in sarA)Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585_S130A
Plasmid#174399PurposeNative S. Typhimurium gene stm2585 (sarA/steE) with N-terminal GFP and Flag tags and its GSK3-binding SxxxSP motif mutated to SxxxAPDepositorInsertsarA
TagsEGFP and FlagExpressionMammalianMutationS130AAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Flag-stm2585_Y167F
Plasmid#174398PurposeNative S. Typhimurium gene stm2585 (sarA/steE) with N-terminal GFP and Flag tags and its STAT3-binding YxxQ motif mutated to FxxQDepositorInsertsarA
TagsEGFP and FlagExpressionMammalianMutationY167FAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Flag-stm2585-gp130
Plasmid#174393PurposeChimera of codon-optimized stm2585 (sarA/steE) and human gp130 sequence.DepositorInsertsarA-IL6ST chimera
TagsFlagExpressionMammalianMutation140-177 of sarA replaced with homologous IL6ST se…Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only