We narrowed to 17,817 results for: multi
-
Plasmid#35079DepositorAvailable SinceApril 4, 2012AvailabilityAcademic Institutions and Nonprofits only
-
pAAV_AR-RE_MLPmin_BC1011-luc2
Plasmid#227106PurposeAndrogen receptor response element for luciferase and barcode assays; barcode BC1011DepositorInsert8x clustered AR response element linked to MLP minimal promoter driving barcode 1011 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGKCMV)-nucTomato-hygro
Plasmid#208573PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato followed by an PGK/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmnucTomato
d2nucEGFP
HygroR
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterPGK/CMV and minPAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2710-pHAGE2-Ef1aL-wtYAP-UBC-tagBFP-loxP
Plasmid#216479Purposelentiviral dual expression of wtYAP (YAP1) and tagBFP with loxP site for Cre excisionDepositorAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNKX2-5-T2A-GFP-PGK-Puro
Plasmid#203607PurposeDonor plasmid to create 3' knockin of NKX2-5 with T2A-GFPDepositorInsertNKX2-5-T2A-GFP-PGK-Puro-NKX2-5 (NKX2-5 Human)
UseHuman targetingAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dCas9-KRAB-gRNA-TRE-blast
Plasmid#201152PurposeLentiviral expression of S. pyogenes dead Cas9 (dCas9/dSpCas9/SpdCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsdCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAMutationgRNA sequence: TACGTTCTCTATCACTGATAvailable SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T5-sfGFP*- MmH-MH4R
Plasmid#196409PurposeExpress sfGFP with TAG and enzymes for biosynthesizing DOPADepositorInsertsExpressionBacterialAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-mPLD3
Plasmid#173853PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD3DepositorInsertPLD3 (Pld3 Mouse)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppBAalbNixE1E2 PUb-GFP
Plasmid#173667Purposetransgenesis vector for Aedes albopictus ectopic expression of the Nix geneDepositorInsertsNix masculinisation gene
EGFP
ExpressionInsectMutationNix isoforms with only exons 1, 2 separated by in…PromoterAedes aegypti Polyubiquitin and cloned Nix promot…Available SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiDP1.2
Plasmid#171095Purposelentiviral construct (3rd generation) for the expression of cell cycle-dependent OsTIR1 fused with mEmerald and Geminin (AKA ROLECCS G2) and miniAID-fused mCherry2DepositorInsertOsTIR1-mEmerald-Geminin-P2A-miniAID-mCherry2
UseLentiviral and Synthetic BiologyTagsEmerald, Geminin, miniAID, mCherry2ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMVA2
Plasmid#119951PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
ExpressionBacterialMutationA110GAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYZ145
Plasmid#98405PurposeDonor DNA plasmid to introduce leu1 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ149
Plasmid#98407PurposeDonor DNA plasmid to introduce his3 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
[UBC][EIF4e][GG cloning]
Plasmid#97189PurposeEIF4e plasmid with Pum cloning siteDepositorInsertEIF4E variant 1 (EIF4E Human)
UseSynthetic BiologyTagsempty Pum cloning siteExpressionMammalianPromoterUBC (ubiquitin C)Available SinceNov. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-agrBD-IV
Plasmid#53440PurposeDerivative of pT7-agrBD-I with a point mutation in the agrD gene to change AIP coding region from type-I to type-IVDepositorInsertagrBD locus (with D29Y mutation in agrD)
UseSynthetic BiologyTagsV5 epitope, 6x HIS (not expressed on agrB or agrD…ExpressionBacterialMutationD to Y mutation of residue 29 of the agrD gene (c…PromoterT7-lacAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1Xpress-BcrGAP
Plasmid#38175DepositorInsertBCR (BCR Human)
TagsXpressExpressionMammalianMutationcontains GAP domain amino acids 1004-1271Available SinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
TDH3pro-rtTA-tetO7pro-T7pol-pRS413
Plasmid#239293PurposeExpresses the reverse tetracycline activator (rtTA) and T7 polymerase; Plasmid #1 of the tet-on overexpression systemDepositorInsertsT7 polymerase with NLS and P278L
reverse tetracycline transactivator (rtTA)
ExpressionYeastMutationContains M2-SE-G72P mutations, described in Addge…PromoterTDH3 and tetracycline-responsive element (TRE) an…Available SinceJune 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-E1MLS-2xFLAG-LigD-IRES-tdTomato
Plasmid#234951PurposeHuman codon optimized LigD (Mycobacterium) with N-terminal E1 MLS expressing plasmidDepositorInsertHuman codon optimized LigD with N-terminal mitochondrial localization signal of pyruvate dehydrogenase E1 subunit
UseLentiviralTagsFLAGExpressionMammalianPromoterEF1AAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBS-KDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XV5
Plasmid#217510PurposeKD Recombinase dependent conditional smGdP-10XV5 cassetteDepositorInsertKDRT-STOP-loxP-3XP3::dsRed-loxP-STOP-KDRT-smGdP-10XV5
TagssmGdP-10XV5ExpressionInsectAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only