We narrowed to 41,013 results for: Eras
-
Plasmid#172415PurposeMAC-tagged gene expressionDepositorAvailable SinceNov. 4, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pCMV-dCas13-inactive M3nls
Plasmid#157854PurposeTargeted m6A RNA methylation in mammalian cells, methyltransferase-inactive mutantDepositorInsertdCas13-inactive dCas13-inactive M3nls (METTL3 Cas13b is from Prevotella sp. P5-125; METTL3 is from H. sapiens)
ExpressionMammalianMutationPspCas13b Δ984-1090 H133A; METTL3 D395AAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sumo3 PolQM1
Plasmid#78462PurposeInducible expression in E. coliDepositorInsertPolymerase theta (POLQ Human)
TagsHis and SUMO3ExpressionBacterialMutationdelta 1-1791; Q2513R (please see depositor commen…PromoterT7Available SinceJuly 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pF145 pAcGFP1 SOD1G93A
Plasmid#26406DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -2
Plasmid#180009PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FOXA1_#2
Plasmid#70096PurposeExpression of shRNA to human FOXA1, puromycin selectionDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-KATNA1
Plasmid#180650PurposeLentiviral expression vector for KATNA1. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. Internal ID: WISP20-47.DepositorInsertKATNA1 (KATNA1 Human)
UseLentiviralTagsmCherryExpressionMammalianMutationsiRNA resistant to: GGACAGCACUCCCUUGAAAAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNK5664
Plasmid#219747PurposeDVK_AF CIDAR vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 under control of CMV promoter, for mammalian expressionDepositorInsertpCMV - nnLuz_v4 - tSV40
UseLuciferaseExpressionMammalianAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-Synaptojanin 1-170
Plasmid#22292DepositorInsertSynaptojanin 1_170 (SYNJ1 Human)
TagsFlagExpressionBacterial and MammalianMutationK334R compared to Genbank ID NM_003895Available SinceOct. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Cry1)-DIO-intron336-dLUC
Plasmid#110056PurposeCry1 transcription luciferase reporterDepositorInsertCry1 promoter and luciferase (Cry1 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterCry1Available SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
EXT1- D164A-pLJC2-3XFLAG
Plasmid#215828PurposeEctopic expression of catalytically inactive mutant (EXT1-D164A-FLAG) in mammalian cellsDepositorInsertExostosin glycosyltransferase 1 Mutant (EXT1 Human)
UseLentiviralTags3X FlagExpressionMammalianAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF150 pSOD1G93AAcGFP1
Plasmid#26411Purposecontains G94A mutation in pSOD1DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -2
Plasmid#180012PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-602_NY-ESO-1_TCR_RFP
Plasmid#207483PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP, NY-ESO-1_TCR
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-831_HA-GD2-28z_CAR_TFAP4_Retroviral
Plasmid#207508PurposeThis plasmid can be used to generate retrovirus.DepositorInsertTFAP4, HA-GD2-28z_CAR (TFAP4 Human)
UseRetroviralAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHes1(467)-luc
Plasmid#41723DepositorInsertHes1 Promoter (-467 to +46) (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoter (-467 to +46)PromoterHes1 promoter fragment (-467 to +46)Available SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
MBP-hnRNPA2_FL_WT
Plasmid#98662PurposeExpresses MBP-tagged full length hnRNPA2DepositorAvailable SinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pF142 pAcGFP1 SOD1 A4V
Plasmid#26403DepositorAvailable SinceNov. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -0
Plasmid#180007PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only