We narrowed to 9,835 results for: CAG
-
Plasmid#112414PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF70DepositorAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
-
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_CASK-1/1
Plasmid#91502PurposeProtein expression and purification of human SH3 domain construct CASK-1/1DepositorInsertCASK-1/1 (CASK Human)
ExpressionBacterialAvailable sinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC3
Plasmid#91181PurposeT-DNA vector for targeted deletion of 58kb region in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable sinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable sinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-EPN-01(ΔL1+L2)
Plasmid#80051PurposeExpression of EPN-01 mutated in both L domainsDepositorInsertEPN-01(deltaPTAP/deltaYP)
TagsMycExpressionMammalianMutationPTAP10AAAA, YP37AAPromoterCMVAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Gg 1.8kb rhodopsin DsRed
Plasmid#72916PurposeRhodopsin promoter from chicken (Gallus gallus) gDNA chr12:19,499,638–19,501,514 in galGal4 driving DsRedDepositorInsertchicken rhodopsin (RHO Chicken)
PromoterrhodopsinAvailable sinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMB-GAr
Plasmid#61173PurposeFluorescent reporter for Golgi apparatus GmMAN49-mCherry expressed under MtBCP1 promoterDepositorInsertGmMAN49-mCherry
ExpressionPlantPromoterMtBCP1Available sinceApril 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPR v2 PC sg1
Plasmid#258098PurposeKnockoutDepositorAvailable sinceAug. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-mCherry-sgPHIP2
Plasmid#259662PurposeAll-in-one lentiviral vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP2), with added feature for monitoring (expression of mCherry)DepositorAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXPR_050_RIOK1-3
Plasmid#258253PurposeLentiviral expression of CRISPRi RIOK1 sgRNA #3DepositorAvailable sinceJuly 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNC-gRNA2
Plasmid#249201PurposesgRNA controlDepositorInsertNon-Targeting
UseCRISPR and LentiviralPromoterU6Available sinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAJS1222 SOCS4-HA-IRES-Puro-T2A-mTagBFP2
Plasmid#250756PurposeVector for lentiviral expression of SOCS4-HA with a Puro-T2A-mTAGBFP2 markerDepositorAvailable sinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#3
Plasmid#235252PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable sinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available sinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 R0+R1+R3 +SV40 base prom-GFP-IRES-AP
Plasmid#225892PurposeEnhancer reporterDepositorInsertR0+R1+R3
TagsEGFPExpressionMammalianAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only