We narrowed to 823 results for: Anti-CRISPR
-
Plasmid#188552PurposeGateway entry vector for sgRNA targeted to MpIGPD.Transient expression of sgRNA targeted to MpIGPD in Marchantia polymorpha.DepositorInsertgR085
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGWBhis03-Citrine-NLS
Plasmid#188558PurposeBinary vector for the expression of Citrine-NLS with MpIGPDm selective marker in Marchantia polymorpha (igpd mutants) .DepositorInsertCitrine-NLS and MpIGPDm
UseCRISPR; Entry vectorTagsExpressionMutationPromoterAvailable sinceMay 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-VP64_Blast
Plasmid#192655Purpose3rd generation lenti vector encoding scFv-VP64 with 2A Blast resistance markerDepositorInsertscFv-VP64
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
Plasmid#172318PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB1678 CMV-HIVNES-GS-Cas13bt1
Plasmid#176316PurposeCMV-HIVNES-GS-Cas13bt1 (human codon optimized Cas13bt1 expression)DepositorInserthuman codon optimized Cas13bt1
UseCRISPRTagsHIV NESExpressionMammalianMutationPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mCherry Codon 59 sgRNA
Plasmid#109431PurposeMLM3636 backbone containing a gRNA that guides Cas9 to codon 59 of mCherry in the ACE reporterDepositorInsertmCherry codon 59 gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-scFv-p65-HSF1-Blast
Plasmid#192652Purpose3rd generation lenti vector encoding scFV-p65-HSF1 with 2A Blast resistance markerDepositorInsertscFv-p65-HSF1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only