-
Plasmid#78607PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23DepositorInsertEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianMutationPromoterEF1a-short; U6Available sinceSept. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (empty, donor)
Plasmid#80768PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains eSpCas9(1.1) and two sgRNA expression cassettes. The first gRNA cloning site is empty.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV_hUbC-dSpCas9-2xVP64-T2A-BSD
Plasmid#162333PurposeLentiviral expression of dSpCas9-2xVP64 with blasticidin resistanceDepositorInsertdSpCas9-2xVP64
UseLentiviralTagsFLAGExpressionMammalianMutationD10A and H840APromoterhUbCAvailable sinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9VP192-T2A-EGFP-shP53
Plasmid#69535PurposeEpisomal plasmid encoding dCas9VP192 and p53 shRNADepositorInsertdCas9-dCas9VP192-GFP-shp53
UseCRISPRTagsEGFPExpressionMutationPromoterCAGAvailable sinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianMutationPromoterSV40, CMV promotersAvailable sinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Cas9-pA-Cry-GFP
Plasmid#168239Purpose"neutrophil specific cas9 expression in zebrafish with green lens"DepositorInsertCas9
UseZebrafish expressionTagsExpressionMutationPromoterAvailable sinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianMutationPromoter173CMV, U6Available sinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gDNMT1.Cas9-T2A-GFP
Plasmid#170362PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.DepositorInsertCas9-T2A-GFP
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha2 P35S:dCas9:VPR:Tnos (GB1826)
Plasmid#160623PurposeTU for the constitutive expression of dCas9 fused to VPR (VP64-p65-Rta) activation domainsDepositorInsertP35S:dCas9:VPR-Tnos
UseTagsExpressionPlantMutationBsaI and BsmBI sites removedPromoterP35SAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIR_TRE_CAG_mKateII-Puro-STOP_mVenus-Cas9-PA-RIR
Plasmid#68345PurposeA Sleeping beauty transposon with conditional expressed hCas9. A red flourescent gene linked to puromycin can be removed in the prescence of Flp recombinase allowing Cas9 expressionDepositorInsertspuromycin
hCas9
UseCRISPR; Flp/frtTagslinked to red flouresent protein gene mKateII and…ExpressionMammalianMutationPromoterCAGAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQCXIN-EF1a-mNeonGreen-P2A-Cas9
Plasmid#189807PurposeRetroviral delivery of Cas9DepositorInsertCas9
UseRetroviralTagsExpressionMutationPromoterAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS-Nvec-codonopti-Cas9-2xNLS
Plasmid#141108PurposePlasmid containing insert for the IVT of nuclear localized Cas9 mRNA with codon optimization for Nematostella vectensisDepositorInsertNematostella codon optimized Cas9
UseUnspecifiedTagsExpressionMutationAll amino acids coded for by codons optimized for…PromoterT7Available sinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH231-EF1-BLST-Cas9-VPR
Plasmid#115147PurposeSafe harbor site 231 knock-in vector with BlastR-Cas9-VPR expression cassetteDepositorInsertBlastR-P2A-Cas9-VPR
UseCRISPRTagsSV40NLSExpressionMammalianMutationPromoterEF1aAvailable sinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorInsertsgHTT1, sgGFP2, shCas9
UseTagsExpressionMammalianMutationPromoterH1, U6, 7SKAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-CjeCas9-sgRNA (KAC482)
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-Ppsba2-dCas9-SpR
Plasmid#73220PurposeContains dCas9 from S. pyogenes under constitutive promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPpsbA2Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-SVI-dCas9-VPR
Plasmid#164575PurposeExpresses an intron-containing dCas9-VPR fusion driven by human SYN promoterDepositorInsertFLAG-dCas9-VPR containing an SV40 intron
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterAvailable sinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L3-Csy4-FokI-dCas9-EGFP-L2
Plasmid#141047PurposeMutisite Gateway mediated vector constructionDepositorInsertCsy4-2A-FokI-dCas9-2A-EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, S. pyogenes, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-EGFP - BAXgRNA1- BAXgRNA2
Plasmid#167296PurposePlasmid encoding for 2 gRNAs targeting the human BAX gene and a CMV driven nuclease Cas9 followed by self-cleaving EGFPDepositorInsertBAX (BAX Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry-UBQ
Plasmid#78932PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAsDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-idCas9-KRAB-Hygro donor
Plasmid#199621PurposeDonor vector for genomic targeting of a Tetracycline-inducible dCas9-KRAB cassette to the human AAVS1/PPP1R12C locusDepositorInsertAAVS1-idCas9-KRAB-Hygro
UseTagsExpressionMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-p300 core
Plasmid#179553Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (IFT88, donor)
Plasmid#80769PurposeExpresses eSpCas9(1.1) and two sgRNAs. The first gRNA targets human IFT88 and the second gRNA targets a pDonor-tBFP-NLS-Neo (Universal).DepositorInsertIFT88 gRNA#1 (IFT88 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorInsertgRNA targeting human TBK1 (TBK1 Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorInsertBRD4 gRNA (BRD4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1TagsExpressionMutationPromoterAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-CBP RING-PHD-HAT
Plasmid#179549Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human CBP RING-PHD-HAT domain (aa 1191-1701) (CREBBP Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-p300 RING-PHD-HAT
Plasmid#179546Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of human p300 RING-PHD-HAT domain (aa 1155-1664) (EP300 Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgPenk
Plasmid#159916PurposeMutagenesis of PenkDepositorInsertPenk (Penk Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZR112_Lenti-SFFV-mCherry-2A-dCas9-VP64
Plasmid#180263PurposeLentiviral expression vector for dCas9-VP64 in mammalian cellsDepositorInsertdCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationNuclease dead Cas9PromoterSFFVAvailable sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-evoCjCas9-PEmax_dRnH-BlastR
Plasmid#194063PurposeMammalian expression of evoCjCas9 PEmax_deltaRnHDepositorInsertevoCjCas9-PEmax_dRnH
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
Plasmid#159914PurposeMutagenesis of Rosa26 with SauCas9DepositorInsertRosa26 gRNA (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2T-CMV-evoCjCas9-ABE8e-BlastR
Plasmid#194060PurposeMammalian expression of evoCjCas9 ABE8eDepositorInsertevoCjCas9-ABE8e
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
UAS-FRT-GFP-FRT-u(M)Cas9
Plasmid#127388PurposeCas9 inducible by removal of a GFP flip-out cassetteDepositorInsertFRT-GFP-FRT-uORF(M)Cas9
UseCRISPRTagsExpressionInsectMutationPromoterAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLGR002 LGR Cas9 guide vector
Plasmid#188320PurposeUniversal backbone for CRISPR/Cas9 sgRNA expressionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsPuroR-T2A-mTagBFP2ExpressionMammalianMutationPromoterpU6 5'CMV and EF1-alphaAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available sinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only