We narrowed to 9,972 results for: crispr plasmids
-
Plasmid#222914PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 4 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm3
Plasmid#222913PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 3 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_NPM2_cterm2
Plasmid#222912PurposeCas9/sgRNA plasmid for targeting NPM2DepositorInsertCas9, NPM2 sgRNA 2 (NPM2 Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAVED-CHAT
Plasmid#214041PurposeBacterial expression plasmid for SAVED-CHAT from Haliangium ochraceumDepositorInsertSAVED-CHAT
ExpressionBacterialMutationWTPromoterlacUV5 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDB2-hCRY2-Luciferase-CD4-bla
Plasmid#189985PurposeDonor Vector to integrate firefly Luciferase C-terminal into the human CRY2 Locus to express it as a fusion proteinDepositorInsertLuciferase
UseCRISPRTags3xFlagAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med1_N_terminal
Plasmid#197870PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med1 N terminal and building mEmerald/Halo-MED1 knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.0RTcgr-Pct5.1-crRNA(AarI)-RT(Δcgr12)
Plasmid#191651PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(nontargeting spacer) cgr1/cgr2-deleting repair template, used as negative control for pXD71Cas10.4RT4DepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TERTp124_Gluc_CCR5
Plasmid#192271PurposeDonor template for insertion of hTERT promoter (-124 C to T) driven Gaussia luciferase reporterDepositorInsertPromoter Reporter Insert within donor template
UseCRISPRMutation-124 C to TPromoterTERT promoter driving expression of gaussiaAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
TERTp146_Gluc_CCR5
Plasmid#192272PurposeDonor template for insertion of hTERT promoter (-146 C to T) driven Gaussia luciferase reporterDepositorInsertPromoter Reporter Insert within donor template
UseCRISPRMutation-146 C to TPromoterTERT promoter driving expression of gaussiaAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gLacZ.EFS-NS.H2B-RFP
Plasmid#170363PurposeNegative control plasmid used for Crispr/cas9 based disruption. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS-KRAB-dCas9
Plasmid#120357PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). KRAB-dCas9 is constitutively expressed.DepositorInsertOK+9MS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [1-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Y365A or A365Y inducible rescue
Plasmid#131323PurposegRNA to generate i-WT-r or i-MT-r systemsDepositorInsertY365A or A365Y inducible rescue
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTF2_KO_ex11_gRNA-4
Plasmid#131334PurposegRNA to knockout MTF2. This gRNA is also used in Haojie Li et al. Nature 2017. It targets exon 11 of MTF2.DepositorInsertMTF2_KO_ex11_gRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-C-del
Plasmid#131516PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-N-delDepositorInsertLMX1B-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
LMX1B-gRNA-N-del
Plasmid#131333PurposegRNA to delete a nucleation site near Lmx1b. Use with LMX1B-gRNA-C-delDepositorInsertLMX1B-gRNA-N-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
HoxD del ds1
Plasmid#131338PurposegRNA to delete a nucleation site near HoxD. Use with HoxD del us1DepositorInsertEVX2-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
SKOR1-gRNA-C-del
Plasmid#131332PurposegRNA to delete a nucleation site near Skor1. Use with SKOR1-gRNA-N-delDepositorInsertSKOR1-gRNA-C-del
UseCRISPRExpressionMammalianAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only