We narrowed to 9,634 results for: bli
-
Plasmid#154071PurposeExpress SARS-CoV-2 NSP1 gene along with HA and BASUDepositorInsertNsp1 (ORF1ab Severe acute respiratory syndrome coronavirus 2)
UseLentiviralExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
iSH-iRFP670-sspB
Plasmid#176102PurposeHeterodimerization with iLID, phosphatidylinositol 3-kinase derived iSHDepositorInsertphosphatidylinositol 3-kinase (Pik3r1 Mouse)
ExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4-WPRE-UbC-Emerald
Plasmid#225943PurposeLentiviral vector plasmid expressing human cytoskeleton associated protein 4 (CKAP4) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS423-mitoT
Plasmid#174525PurposeExpresses yeast variant of mitoT synthetic intermembrane tether bridging the inner and outer mitochondrial membranesDepositorInsertYeast mitochondrial intermembrane tether
UseSynthetic BiologyTagseGFPExpressionYeastPromoterMET25Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21-10XHis-GST-HRV-Her2-dL5-Her2
Plasmid#85624PurposeBacterial expression vector for Z342-dL5(E52D)-Z342 affibody fusion protein (AFA) with N-terminal His10, GST and HRV3C cleavage site (MBIC5, dL5**, FAP, AffiFAP)DepositorInsert10XHis-GST-HRV-Her2-dL5-Her2 (EGFR Human, Schistosoma japonicum, Synthetic)
Tags10XHis-GST-HRV and The Her2 Affibody and dL5 FAP …ExpressionBacterialMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterT7Available SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA BfuAI stuffer G-tract
Plasmid#138524PurposeExpresses a guide RNA of choice cloned into the BfuI site extended at the 3' end to incorporate a 220-nt PRC2-binding G-tract repeat RNA sequence.DepositorInsertPRC2-binding G-tract repeat RNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRCreb5gRNA
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXs-hGLIS1GR
Plasmid#59312PurposeForced expression of human GLIS1GRDepositorInsertGLIS1 (GLIS1 Human)
UseRetroviralTagscGR - hormone binding domain of glucocorticoid re…ExpressionMammalianAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pQC hKGA.wt V5-His IRES G418
Plasmid#110390Purposeγ-Retroviral transfer vector for expressing glutminase isoform KGA (wild type), C-terminal V5-6xHis tags, IRES-driven Geneticin selection.DepositorInsertKGA glutaminase (GLS Human)
UseRetroviralTags6xHis and V5ExpressionMammalianPromoterCMVAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFP
Plasmid#166676PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertsVP2C-GFP
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA 27
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA3
Plasmid#59308PurposeKnockdown of human FOXH1DepositorAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
LP344
Plasmid#90174PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-370DepositorAvailable SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
LP241
Plasmid#90173PurposepEGFP-N1 with cDNA encoding HsKIF13B aa residues 1-557DepositorAvailable SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
LP346
Plasmid#90175PurposepEGFP-C1 with cDNA encoding HsKIF13B aa residues 1-1000DepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
TH-neo donor vector
Plasmid#247669Purposeknock-in vector to express neo from endogenous TH geneDepositorAvailable SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
CBS-6182
Plasmid#253632PurposeExpression of GFP target and CAO1 non-targeting spacer arrayDepositorInsertJ23119 GFP T14 target + CAO1 5x array non-targeting
ExpressionBacterialMutationN/APromoterJ23119Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
CBS-6181
Plasmid#253631PurposeExpression of GFP target and GFP targeting spacer arrayDepositorInsertJ23119 GFP T14 target + GFP T14 5x array targeting
ExpressionBacterialMutationN/APromoterJ23119Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
CBS-6180
Plasmid#253630PurposeExpression of GAPDH target and CAO1 non-targeting spacer arrayDepositorInsertJ23119 GAPDH T17 target + CAO1 5x array non-targeting
ExpressionBacterialMutationN/APromoterJ23119Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only