We narrowed to 24,454 results for: ina
-
Plasmid#13688DepositorAvailable SinceMarch 5, 2007AvailabilityAcademic Institutions and Nonprofits only
-
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUW-crRNA1and2-U6_TRE-dLbCpf1-NLS-hCTCF_WT-HA-P2A-tagBFP
Plasmid#194885PurposeDox-inducible all-in-one lentiviral construct to express dCpf1-CTCF-WT and crRNA-1 and -2 targeting the human MECP2 locus.DepositorInsertsdLbCpf1-NLS-hCTCF_WT
U6-crRNA1and2
UseLentiviralTagsHAMutationHuman codon optimized catalytically inactive LbCp…PromoterTRE and U6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
mcherry p62 delta UBA silent
Plasmid#187984Purposemcherry p62 lacking UBA domain (aa389-434) but it has the silent mutations to be resistant to sip62. Internal reference: SMC572DepositorInsertp62 (NUP62 Human)
TagsmCherryExpressionMammalianMutationLacking UBA domain (aa389-434) but it has the sil…Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnEA-vH_His-TEV-SEPT2-msfGFP_SEPT6
Plasmid#174498Purposebacterial co-expression of human SEPT2 fused to monomeric superfolder GFP and of human SEPT6DepositorTagsHis6-TEV and msfGFPExpressionBacterialAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i5-TEV-Strep
Plasmid#174502Purposebacterial co-expression of human SEPT7 and of human SEPT9_i5DepositorAvailable SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac SpyTag-β2AR-SpyTag
Plasmid#135620PurposeExpression of SpyTag-B2AR in insect cellDepositorInsertBeta 2 adrenergic receptor (ADRB2 Human)
TagsHA-FLAG tag, Spytag, and eGFP-10xHis-R1D4 tagExpressionInsectMutationDeleted 1-24 aa, 366-413 aaAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
ISG15 C-term. Domain intein/chitin binding domain (79-156)
Plasmid#110760PurposeBacterial expression of ISG15 C-term.DepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR SFFVp BFP-Erk D319N
Plasmid#102350PurposeLentiviral expressing translational fusion between blue fluorescent protein and Erk2 bearing the D319N mutationDepositorInsertErk2 (Mapk1 Mouse)
UseLentiviralTagsBFPMutationAspartic acid 319 was mutated to asparaginePromoterSFFVAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAD mApple
Plasmid#91772PurposeBacterial expression of a fluorescent protein, monomeric Apple (mApple). Note: Addgene identified several mutations compared to the final published sequence.DepositorInsertmonomeric Apple
TagsHexa-Histidine tag, Xpress epitope for detection …ExpressionBacterialMutationR97K, E152S, A180S, V207T compared to mApple (FP …PromoteraraBADAvailable SinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pc-FLAGCSK-SH3-SH2 (2 to 190 amino acids)
Plasmid#74505PurposeOverexpression of CSK SH3-SH2 in mammalian cellsDepositorAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET3a hRegIIIa
Plasmid#64937Purposebacterial expression of processed human RegIIIalphaDepositorInsertRegIIIa (REG3A Human)
ExpressionBacterialMutationprocessed form. mutations made in 5' end to …PromoterT7Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
SERA5-bio-His
Plasmid#50817PurposeExpresses enzymatically monobiotinylated full length SERA5DepositorInsertSERA5
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
SERA1-bio-His
Plasmid#50812PurposeExpresses enzymatically monobiotinylated full length SERA1DepositorInsertSERA1
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
GLURP-bio-His
Plasmid#50802PurposeExpresses enzymatically monobiotinylated full length GLURPDepositorInsertGLURP
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP6-bio
Plasmid#47732PurposeExpresses enzymatically monobiotinylated full-length MSP6 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP6
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
MSP5-bio
Plasmid#47718PurposeExpresses enzymatically monobiotinylated full-length MSP5 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSP5
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXs-EGFP-ERas SSVA-IP
Plasmid#13827DepositorInsertERas SSVA (Eras Mouse)
UseRetroviralTagsEGFPExpressionMammalianMutationC224 changed to serineAvailable SinceMarch 16, 2007AvailabilityAcademic Institutions and Nonprofits only