We narrowed to 27,121 results for: GFP
-
Plasmid#44969DepositorInsertGFP-UVR8 (UVR8 Synthetic, Mustard Weed)
TagsGFPExpressionMammalianMutationdeleted Methionine 1PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcryGFP-acta1-dmdGFP
Plasmid#172530PurposealphaA-crystallin promoter (cry) drives GFP expression in the lens. The acta1 muscle-specific promoter drives expression of GFP-tagged zebrafish dmd.DepositorAvailable SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
FSW_SUN1_GFP
Plasmid#205985PurposeExpresses hSyn1-driven, GFP-tagged SUN1 to label neuronal nucleiDepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-KAR2-msGFP2-HDEL
Plasmid#160468PurposeYeast integration vector for the gene replacement of S. cerevisiae KAR2 fused to msGFP2 with an ER retrieval signalDepositorInsertKAR2-msGFP2-HDEL
ExpressionYeastAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
KIF3A560GFP
Plasmid#129769PurposeExpresses mouse Kinesin-2 KIF3A head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKIF3A (Kif3a Mouse)
TagsGFP and His6ExpressionBacterialMutationTruncation at 359, fused to kinesin-1 starting Al…Available SinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-GFP-Sec61β
Plasmid#186597PurposeThird generation lentiviral vector expressing GFP-Sec61βDepositorAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-SOX2-IRES-GFP
Plasmid#183909PurposeExpression of human SOX2 and GFP under the human GFAP ABC1D promoterDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
prs316 CUP-GFP
Plasmid#128052PurposeYeast expression vector for N terminal GFP fusionsDepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Synthetic, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcGFP-Hyg-CTCF-N1
Plasmid#131799PurposeExpresses human CTCF-GFP in mammalian cells through transient transfectionDepositorAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
CuGFP-ATG8(416)
Plasmid#49423PurposeExpresses ATG8 fused at the N terminus to GFP under the control of the CUP1 promoter.DepositorInsertautophagy-related 8 (ATG8 Budding Yeast)
TagsGFPExpressionBacterial and YeastPromoterCUP1Available SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-L10X-GFP
Plasmid#108587PurposeExpresses PKAcs-GFP fusion in mammalian cells with structured linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
UBXD1-GFP
Plasmid#86464PurposeExpression of human UBXD1 with C-terminal GFP tagDepositorAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-roGFP1-R12
Plasmid#83311PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertroGFP1-R12
Tags6xHISExpressionBacterialMutationC48S/Q80R/S147C/Q204C/N149K/F223R/S202KPromoterT7Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcryBFP_Umyo18bGFP
Plasmid#172527PurposealphaA-crystallin promoter (cry) drives GFP expression in the lens. The 600bp unc-45b muscle-specific promoter drives expression of GFP-tagged zebrafish Myo18b.DepositorInsertmyo18b
ExpressionMammalianAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
N1-mSin1.5-GFP
Plasmid#72909PurposeGFP-tagged mSin1 (isoform 5)DepositorInsertTarget of rapamycin complex 2 subunit MAPKAP1, isoform 5 (MAPKAP1 Human)
TagseGFPExpressionMammalianAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only