We narrowed to 6,879 results for: crispr cas9 plasmids
-
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
ExpressionBacterialMutationD10A & H840AAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOSIP-KH-RBS2-dCas9
Plasmid#182740PurposeIntegrative plasmid at the HK022 site in E. coli carrying dCas9 under the control of a Ptet promoterDepositorInsertdCas9
UseCRISPR; Integrative vectorPromoterPtetAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_puro
Plasmid#108100PurposeLentiviral expression plasmid of spCas9 with puromycin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-P2-SpCas9
Plasmid#232354PurposeThe plasmid pBBR1-P2-SpCas9 employs pBBR1MCS-2 as the vector, with Cas9 protein derived from S. pyogenes and the stationary phase promoter P2 sourced from S. marcescens HBQA7.DepositorInsertsCas9
sacB
UseCRISPRPromoterpromoter P2 from S. marcescens HBQA7Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only