We narrowed to 27,539 results for: GFP
-
Plasmid#202569PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the R261A mutation and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Arginine 261 to AlanineAvailable sinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GFP-Sec61β
Plasmid#186597PurposeThird generation lentiviral vector expressing GFP-Sec61βDepositorAvailable sinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-IRAlus-Lin28
Plasmid#92347PurposePlasmid for expression of GFP gene with a Lin28 gene derived IR Alu element containing 3'UTR.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLin28 gene derived IR Alu element containing 3'UTR (LIN28A Human)
ExpressionMammalianPromoterCMVAvailable sinceJune 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-CYLD-STOP
Plasmid#60077PurposeN-terminal GFP tagged CYLD with stop codon, driven by CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCylindromatosis (CYLD Human)
TagsGFPExpressionMammalianPromoterCMVAvailable sinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP553‐1
Plasmid#87240Purposegtbp‐1 (~500 bp flanking sequence)::GFP (with 3 introns)::gtbp‐1 (~500 bp flanking sequence)DepositorInsertgtbp‐1 (~500 bp flanking sequence)::GFP (with 3 introns)::gtbp‐1 (~500 bp flanking sequence)
Available sinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIRESN2 GFP-uvr8at
Plasmid#44969DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP-UVR8 (UVR8 Synthetic, Mustard Weed)
TagsGFPExpressionMammalianMutationdeleted Methionine 1PromoterpCMV IEAvailable sinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pARNTL-donor
Plasmid#112384PurposeCRISPR donor plasmid to tag human transcription factor ARNTL with GFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertARNTL homology arms flanking EGFP-IRES-Neo cassette (BMAL1 Human)
UseCRISPRAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Integrin β5-GFP
Plasmid#205090PurposeExpress GFP-tagged human integrin β5 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertIntegrin beta 5 (ITGB5 Human)
TagsGFPExpressionMammalianAvailable sinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cas9-GFP_sg_mAMPKa1
Plasmid#79004PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPrkaa1 (Prkaa1 Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
YIplac211-KAR2-msGFP2-HDEL
Plasmid#160468PurposeYeast integration vector for the gene replacement of S. cerevisiae KAR2 fused to msGFP2 with an ER retrieval signalDepositorInsertKAR2-msGFP2-HDEL
ExpressionYeastAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEGO-pDHS-AP1x6-MGM264
Plasmid#217417PurposeLuciferase expression vector with 6 AP-1 sites and the full length GM-CSF promoter, and a chromatin priming element. Alias: LEGO-MGM264-AP-1x6DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoterMouse -284 to +28 full length CSF2 promoterAvailable sinceAug. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
KIF3A560GFP
Plasmid#129769PurposeExpresses mouse Kinesin-2 KIF3A head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertKIF3A (Kif3a Mouse)
TagsGFP and His6ExpressionBacterialMutationTruncation at 359, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-hGFAP-SOX2-IRES-GFP
Plasmid#183909PurposeExpression of human SOX2 and GFP under the human GFAP ABC1D promoterDepositorAvailable sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
prs316 CUP-GFP
Plasmid#128052PurposeYeast expression vector for N terminal GFP fusionsDepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1alpha-soCoChR-GFP
Plasmid#107709PurposeA somatic channelrhodopsin, which enables single cell, single millisecond resolution optogenetics. EF1alpha promoterDepositorInsertsoCoChR-GFP
UseAAVTagsEGFP and KA2ExpressionMammalianPromoterEF1alphaAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Synthetic, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CRY2-OCRL
Plasmid#79565Purposeexpression of GFP-tagged CRY2PHR fused to inositol 5-phosphatase domain of OCRLDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOCRL (OCRL Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationaa 234_539PromoterCMVAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
CuGFP-ATG8(416)
Plasmid#49423PurposeExpresses ATG8 fused at the N terminus to GFP under the control of the CUP1 promoter.DepositorInsertautophagy-related 8 (ATG8 Budding Yeast)
TagsGFPExpressionBacterial and YeastPromoterCUP1Available sinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by