We narrowed to 9,513 results for: control
-
Plasmid#175004Purposenon-standard AAV2 rep-AAV.CAP-B10 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B10 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ER-mRFP
Plasmid#231176PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with mRFP, in mammalian cellsDepositorInsertER-mRFP
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCTRL
Plasmid#209750PurposeLentiviral transfer plasmid to express Cas9 and a control, non-specific gRNA (does not target any human gene)DepositorInsertCas9
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-EF1A>Tet3G:IRES:Neo
Plasmid#198756PurposeVector encodes a Tet-On Advanced transactivator under control of a constitutive EF1α promoter and confers resistance to the antibiotic G418DepositorInsertTet3G, IRES, Neo
UseLentiviralPromoterEF1AAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B22
Plasmid#175005Purposenon-standard AAV2 rep-AAV.CAP-B22 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B22 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-ER-mRFP
Plasmid#231180PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with mRFP, from a lentiviral vectorDepositorInsertER-mRFP
UseLentiviralPromoterCMVAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F2-empty vector
Plasmid#125552PurposeN2H assay vector with nanoluc fragment2 (empty control, no Gateway cloning site, expressing nanoluc fragment2)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-F1-empty vector
Plasmid#125551PurposeN2H assay vector with nanoluc fragment1 (empty control, no Gateway cloning site, expressing nanoluc fragment1)DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment1 alone without any attached prot…ExpressionMammalian and YeastPromotersynthetic promoter containing yeast, mammalian, a…Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN5(TA)-ires-puro
Plasmid#167823Purposecontrol sensor for EKAREN5DepositorInsertEKAREN5(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ER-EBFP2
Plasmid#231183PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with EBFP2, in mammalian cellsDepositorInsertER-EBFP2
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60228PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
DRH002_scAAV-hSyn-delta_iCre-HA
Plasmid#225087PurposeExpression of inactive delta-iCre (control) with an HA tag in neurons driven by human synapsin promoter.DepositorInsertdelta_iCre
UseAAV and Cre/LoxTagsHAExpressionMammalianPromoterhSynAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBFC0619
Plasmid#186690PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, GmR+sfGFP cargoDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
Vc_2xBsaI_NT (Guide Stuffer) crRNA
Tn7 transposon
GmR+sfGFP VcDART Cargo
ExpressionBacterialPromoterPLacAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBFC0996
Plasmid#186695PurposeVcDART under control of Lac promoter, Vc_2xBsaI_NT gRNA, 2xLguI cargo stuffer, with ET-Seq (AsiSI+SbfI) restriction sites flanking Tn7 Right EndDepositorInsertstnsA
tnsB
tnsC
tnsD
tniQ
cas8-cas5 fusion
cas7
cas6
crRNA
Tn7 transposon
2xLguI Cargo Stuffer
SbfI+AsiSI dual restriction site for donor plasmid removal during ET-Seq
ExpressionBacterialPromoterPLacAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1β-hHNF4α-hHNF6-EF1α-Bla
Plasmid#199551PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1β-hHNF4α-hHNF6) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-PPO-Venus
Plasmid#139505PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV8 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterEf1aAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pBG-mCRE98-NLS-EGFP-WPRE
Plasmid#239977Purposeadeno-associated virus (AAV) encoding enhanced green fluorescent protein (eGFP) under motor neuron-selective control of minimal beta globin promoter (pBG) and CRE98DepositorAvailable SinceJune 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only