We narrowed to 4,523 results for: GCA;
-
Plasmid#78006Purpose3rd generation lentiviral gRNA plasmid targeting human PRPS2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC2
Plasmid#91180PurposeT-DNA vector for combinatorial deletion of NCR genes in medicago truncatula (Csy4 array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting NCR genes
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pMIR-31-Reporter
Plasmid#71871PurposeMammalian expression vector for the analysis of miR-31 activityDepositorInsertReverse complementary sequence of miR-31
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDE714
Plasmid#103021Purposeexpression of a Cpf1 programming crRNA targetting HIS4 (crHIS4-4.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGrin2a
Plasmid#124863PurposeMutagenesis of Grin2aDepositorInsertGrin2a (Grin2a Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Intron4-PAFAH1B1
Plasmid#92434Purposeexpresses Cas9 and gRNA targeting PAFAH1B1DepositorAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_3
Plasmid#36337DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
SGK1 gRNA (BRDN0001147869)
Plasmid#77458Purpose3rd generation lentiviral gRNA plasmid targeting human SGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pPN269
Plasmid#91632PurposeExpress sgRNA targeting human KCNB1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SGK1 gRNA (BRDN0001146486)
Plasmid#77459Purpose3rd generation lentiviral gRNA plasmid targeting human SGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX459-Itgb1 gRNA
Plasmid#246577PurposeCRISPR vector co-expressing Cas9 and a mouse Itgb1 gRNADepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-2
Plasmid#177782PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-30kb-DSF
Plasmid#227483Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-30kb-DSF
Plasmid#227484Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-35kb-DSF
Plasmid#227490Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-66kb-DSF
Plasmid#227497Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 66kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-29kb-USF
Plasmid#227466Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 29kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-7-12
Plasmid#227471Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-1.9kb-USF
Plasmid#227476Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 1.9kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only