We narrowed to 8,858 results for: sgRNA
-
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK3/PERK_sgRNA
Plasmid#218666PurposesgRNA targeting human EIF2AK3/PERKDepositorInsertEIF2AK3 (EIF2AK3 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV enAsCas12f-HKRA-sgRNA_v7
Plasmid#208357PurposeExpression of enAsCas12f-HKRA and sgRNA_v7 in mammalian cellsDepositorInsertenAsCas12f-HKRA
ExpressionMammalianMutationI123H/D195K/D208R/V232APromoterCMVAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-DR-SgRNA-DR-EF1a-mCherry-SV40
Plasmid#154002PurposeEmpty SgRNA expression system matching CasRxDepositorInsertSgRNA expression system
UseCRISPRPromoterU6, EF1aAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-U6-sgRNA-BFP-Puro
Plasmid#229014PurposePerturb Seq lentiviral sgRNA vectorDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
OpenCRISPR-1 sgRNA-16nt stem
Plasmid#221566PurposeExpress OpenCRISPR-1 sgRNA (16nt stem loop) in human cells using a U6 promoter. Plasmid also encodes a CMV-driven GFP reporter.DepositorInsertOpenCRISPR-1 sgRNA 16nt stem loop
ExpressionMammalianPromoterU6Available SinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3-U6-sgRNA-PGK-puromycin
Plasmid#51133Purposeexpresses sgRNA from the U6 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV enAsCas12f-YHAM-sgRNA_v7
Plasmid#208356PurposeExpression of enAsCas12f-YHAM and sgRNA_v7 in mammalian cellsDepositorInsertenAsCas12f-YHAM
ExpressionMammalianMutationF48Y/S188H/V232A/E316MPromoterCMVAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato-TSC2-sgRNA
Plasmid#196195PurposeEditing human TSC2 locusDepositorInsertTSC2 (TSC2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2) cloning backbone
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
OpenCRISPR-1 sgRNA-12nt stem
Plasmid#221567PurposeExpress OpenCRISPR-1 sgRNA (12nt stem loop) in human cells using a U6 promoter. Plasmid also encodes a CMV-driven GFP reporter.DepositorInsertOpenCRISPR-1 sgRNA 12nt stem loop
ExpressionMammalianPromoterU6Available SinceAug. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMD19-PBBa_J23117-sgRNA-Spr
Plasmid#190793PurposeTemplate vector to amplify single sgRNAs or pieces for multiplexing arrays. Has flanking BsaI-sites.DepositorInsertsgRNA (dummy)
UseSynthetic BiologyExpressionBacterialPromoterBBa_J23117Available SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgRNA
Plasmid#124845PurposeVector for FLP-dependent expression of SaCas9 with gRNADepositorInsertSauCas9 gRNA scaffold
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCMVAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only