We narrowed to 12,778 results for: NUC
-
Plasmid#174797PurposeBacterial expression of a hyperactive PARP1 mutant (A870L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pET28_6xHis-PARP1-K893I
Plasmid#174799PurposeBacterial expression of an inactive mutant (K893I may disrupt NAD+ binding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263E
Plasmid#141340PurposeLentiviral vector for expression of human NHEJ1-S263E in mammalian cellsDepositorInsertNHEJ1-S263E (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263EPromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cn-VA-NHEJ1-S263A
Plasmid#141341PurposeLentiviral vector for expression of human NHEJ1-S263A in mammalian cellsDepositorInsertNHEJ1-S263A (NHEJ1 Human)
UseLentiviralTagsVA tag (3XFLAG-2XTEV-6XHis-2XStrep-Beacon)ExpressionMammalianMutationS263APromoterCMVAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3
Plasmid#124435PurposeChimeric ETS domain: H3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis TagExpressionBacterialMutationResidues 225 to 239 replaced with corresponding s…Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-Loop
Plasmid#124551PurposeChimeric ETS domain: Loop of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 216 to 223 replaced with corresponding s…Available SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_R89A-PolyA
Plasmid#112291PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) R89A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Arginine 89 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_L91A-PolyA
Plasmid#112292PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) L91A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Leucine 91 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_F95A-PolyA
Plasmid#112293PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) F95A mutantDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with Phenylalanine 95 to AlaninePromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-H3/S3
Plasmid#124627PurposeChimeric ETS domain: H3/S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 237 to 241 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28B-PU.1-ETS-S3
Plasmid#124550PurposeChimeric ETS domain: S3 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 242 to 246 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-PU.1-ETS-H2
Plasmid#123358PurposeChimeric ETS domain: H2 of Ets-1 in PU.1 scaffoldDepositorTags6xHis tagExpressionBacterialMutationResidues 207 to 215 replaced with corresponding s…Available SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-2xmiR-122 target sites
Plasmid#120295PurposeAAV Vector for expression of C-terminal SpyCas9 fragement with split-intein and a CMV-driven AcrIIA4 with two miR-122 binding sitesDepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_6ntmut
Plasmid#73075Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_hE2F7mg_10ntmut
Plasmid#73076Purposehuman E2F7 minigene (exons 11,12,13/introns cassette) with mutated snord27 binding siteDepositorInsertE2F7 (E2F7 Human)
ExpressionMammalianMutationpartial gene, exons 11,12,13 spaced by introns wi…Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL5 sgRNA(MS2)-MS2-hA3a D131A
Plasmid#112131Purposeempty sgRNA cloning vector with MS2-humanA3a D131ADepositorInserthuman Apobec3a D131A mutant (APOBEC3A Human)
UseCRISPRExpressionMammalianMutationD131A mutant in hA3aPromoterhU6,CBhAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 E2F1 Flag(Δ193-359) (HindIII- BamHI- EcoRI)
Plasmid#70667PurposeHuman mutant of E2F1 lacking amino acids 193-359DepositorInsertE2F1 lacking residues 193 to 359 (E2F1 Human)
TagsFLAGExpressionMammalianMutationlacks amino acids 193-359PromotercmvAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only