We narrowed to 17,594 results for: cript
-
Plasmid#86156PurposeLentiviral fluorescent reporter using the neuronal cell type-specific promoter of the CaM Kinase II alpha gene.DepositorInsertmKO2
UseLentiviralAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-puro-TTF-1-HDD
Plasmid#74991PurposeRetroviral vector holding human TTF-1 (NKX2-1) with the homeodomain deletedDepositorInsertTTF-1 HDD mutant (NKX2-1 Human)
UseRetroviralTagsNoneExpressionMammalianMutationHDD = homeodomain deletedAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
1130 pBabe puroL HA FKHR H215R AAA
Plasmid#9035DepositorInsertFKHR H215R AAA (FOXO1 Human)
UseRetroviralTagsHAExpressionMammalianMutationH215R T24A S256A S319AAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DRD1-NNES-eLOV-TEVcs-Flag-Gal4-V5
Plasmid#125227PurposeExpresses SPARK DRD1 transmembrane component in mammalian cellsDepositorInsertDRD1-NNES-eLOV-TEVcs-Flag-Gal4-V5
UseAAVTagsFlag, V5ExpressionMammalianPromoterCMVAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
-111 hTF m1
Plasmid#15448DepositorAvailable SinceJuly 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
Pmyo3::tag:sl1(G16C)
Plasmid#79003PurposeExpression of exogenous SL1 in C. elegans muscleInsertsls-1.2 (sls-1.2 Nematode)
Tagsillumina-adapterExpressionWormMutationG16CPromotermyo-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC625
Plasmid#62321PurposesgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cellsDepositorInsertsgRNA +1x MS2, Pol II promoter with ribozyme cleavage
ExpressionYeastPromoterpAdhAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_IRF9
Plasmid#187738PurposeMAC-tagged gene expression of human IRF9DepositorInsertIRF9 (IRF9 Human)
ExpressionMammalianAvailable SinceAug. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Tight-Puro_Myt1
Plasmid#64845PurposeA lentiviral vector for the expression of mouse Myt1 under doxycyline controlDepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIhh742bp-Luc
Plasmid#53605PurposeReporter construct containing a 742 bp promoter region of the Ihh gene in front of a luciferase gene for in vitro DNA transfection assaysDepositorInsertIhh promoter
UseLuciferase; ReporterAvailable SinceJune 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
p5A0-T
Plasmid#92016PurposeExpresses TALE targeted to lac operator without TEV cut sites, anhydrotetracycline inducible TEV proteaseDepositorInsertsTALE targeting lac operator
Tobacco Etch Virus Protease
UseTALENTags5x Arginine Tag, 6x His Tag, 7x His Tag, and FLAG…MutationS219VPromoterJ23102 Promoter (from Anderson promoter library) …Available SinceJan. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCFL-mPML-2CAMut-iB
Plasmid#140286PurposeExpression of mouse PML Ca mutantDepositorAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
459 pME-etv2
Plasmid#49002Purposefull length coding sequence for zebrafish etv2 gene in gateway middle entry vectorDepositorInsertets variant gene 2 (etsrp Zebrafish)
UseGateway middle entryAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
GST-FOXO3a 1-506aa
Plasmid#10826DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-2x
Plasmid#172282PurposeExpressing EGFP mRNA fused with 2 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-2x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-4x
Plasmid#172283PurposeExpressing EGFP mRNA fused with 4 tandem repeats of a 50-base sequenceDepositorInsertEGFP-N1-4x
ExpressionMammalianPromoterCMVAvailable SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
GST-FOXO3a TM 1-506aa
Plasmid#8351DepositorAvailable SinceDec. 2, 2005AvailabilityAcademic Institutions and Nonprofits only -
miR-34aM3
Plasmid#50829Purposeluciferase reporter for human miR-34aDepositorInsertmiR-34A promoter M3 (MIR34A Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationthird NF-kB binding site mutated (-149)PromotermiR34aAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
miR-34aM1
Plasmid#50827Purposeluciferase reporter for human miR-34aDepositorInsertmiR-34A promoter M1 (MIR34A Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationfirst NF-kB binding site mutated, (-539)PromotermiR34aAvailable SinceApril 9, 2014AvailabilityAcademic Institutions and Nonprofits only