We narrowed to 27,414 results for: gfp
-
Plasmid#163642Purposerps-27>DHB::GFP-P2A-H2B::2xmKate2 expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::GFP-P2A-H2B::2xmKate2::3xHA (his-58 Human, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available sinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD2087-trnDEG
Plasmid#89369PurposeMosSCI targeting vector expressing a fusion between a GFP nanobody and an ubiquitin ligase adaptor ZIF-1 to degrade GFP tagged proteins. Expression is controlled by Pmec-18 (touch neuron specific).DepositorInsertvhhGFP4-ZIF-1 (zif-1 Synthetic, Nematode)
UseTargeting vector for mos1 transposon mediated sin…TagsvhhGFP4 (GFP nanobody)PromoterPmec-18Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pgRGFP
Plasmid#82695PurposeExpresses gRNA of interest under U6 promoter (cloning by BpiI) and GFP under PGK promoter.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterPGK, U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMXspuro-GFP-NBR1-dUBA
Plasmid#74205PurposeRetroviral expression of GFP-NBR1 with aa 877 mutation to generate a premature stop codonDepositorInsertneighbor of BRCA1 gene 1 (NBR1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationChanged aa 877 to encode for premature stop codonAvailable sinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-FKBP-TACC3-shTACC3
Plasmid#59354PurposeKnocks down endogenous TACC3 and expresses RNAi-resistant human TACC3 tagged with GFP & FKBP in mammalian cells.DepositorInsertTransforming Acidic Coiled Coil protein 3 (TACC3 Human)
UseRNAiTagsEGFP and FKBPExpressionMammalianPromoterCMVAvailable sinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
His-GFP-Rab27a
Plasmid#170861PurposeMammalian expression of His-GFP-Rab27a.DepositorAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Rab3a
Plasmid#170863PurposeMammalian expression of His-GFP-Rab3a.DepositorAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Rabphilin
Plasmid#170865PurposeMammalian expression of His-GFP-Rabphilin.DepositorAvailable sinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLC242-GFP-Sestrin2
Plasmid#100519PurposeExpresses GFP tagged Sestrin2 in mammalian cells to make lentivirusDepositorPublicationAvailable sinceDec. 28, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EGFP-IC2-N106
Plasmid#51411Purposeexpression of GFP-tagged N-terminal AA 1-106 of dynein intermediate chain IC2C in mammalian cellsDepositorAvailable sinceMarch 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-eGFP-hTau-WPRE-pA
Plasmid#255025PurposeLentiviral plasmid designed to express a fusion protein of enhanced GFP and human TauDepositorInsertTau/MAPT (MAPT Human)
UseLentiviralAvailable sinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry
Plasmid#170184PurposeExpression vector for a sgRNA against BFP and spCas9-Sa163 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Sa163 msr-msd region by SpeI and AvrII.DepositorInsertsSa163 RT
Retron Sa163 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianPromoterCBh and hU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL1-GFP
Plasmid#67395PurposeMammalian expression of hArl1 with C-term GFP tagDepositorInsertARL1 (ARL1 Human)
TagsGFPExpressionMammalianMutationbp 231 C to T; silent mutationPromoterCMVAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-FnCas9GFP
Plasmid#130966Purposeexpression of FnCas9-GFP in bacterial cellsDepositorInsertHA-NLS-FnCas9
UseCRISPRTags6xHis-mEGFP-TEV-HA-NLSExpressionBacterialPromoterT7Available sinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PKAcs-nolinker-GFP
Plasmid#108579PurposeExpresses PKAcs-GFP fusion in mammalian cellsDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-KR6X-GFP
Plasmid#108585PurposeExpresses PKAcs-GFP fusion in mammalian cells with structured linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PKAcs-G12X-GFP
Plasmid#108588PurposeExpresses PKAcs-GFP fusion in mammalian cells with flexible linkerDepositorInsertprotein kinase A, catalytic subunit
TagsGFPExpressionMammalianMutationH87Q and W196RAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-RAB35
Plasmid#164630PurposeExpresses RAB35 in mammalian cells with a GFP tagDepositorAvailable sinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only