We narrowed to 1,992 results for: RP1
-
Plasmid#75811Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorInsertSTKLD1 (C9orf96 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STKLD1 gRNA (BRDN0001148566)
Plasmid#75812Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorInsertSTKLD1 (C9orf96 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STKLD1 gRNA (BRDN0001162456)
Plasmid#75813Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorInsertSTKLD1 (C9orf96 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Bsd-CMV-MDM4
Plasmid#202669PurposeMDM4 overexpression vector with blasticidin resistanceDepositorInsertMDM4 regulator of p53 (MDM4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-MDM4
Plasmid#195140PurposeTet-ON 3rd generation expression vector with inducible expression of MDM4 and a puromycin selection cassetteDepositorInsertMDM4 (MDM4 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001145987)
Plasmid#77773Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorInsertLRPPRC (LRPPRC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRPPRC gRNA (BRDN0001147349)
Plasmid#77774Purpose3rd generation lentiviral gRNA plasmid targeting human LRPPRCDepositorInsertLRPPRC (LRPPRC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-MFSD13A_STOP
Plasmid#161118PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertMFSD13A (TMEM180 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2594
Plasmid#144048PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertBHLHE41 (BHLHE41 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-C2
Plasmid#125559PurposeGateway compatible N2H assay destination vector with C-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to c-terminus of Gatew…ExpressionMammalian and YeastMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-N2H-N2
Plasmid#125548PurposeGateway compatible N2H assay destination vector with N-terminus tagging of nanoluc fragment2DepositorTypeEmpty backboneUseIn vitro expressionTagsNanoLuc fragment2 attached to n-terminus of Gatew…ExpressionMammalian and YeastMutationPromotersynthetic promoter containing yeast, mammalian, a…Available sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYX233-b2-DHFR
Plasmid#163759PurposeGal-inducible yeast expression of the mitochondrial "clogger" protein b2(167)-DHFRDepositorInsertb2-DHFR (Dhfr Budding Yeast, Mouse)
UseTagsExpressionYeastMutationAmino acids 1-167 of S.c. Cytochrome b2 (Cyb2) fu…PromoterGAL1Available sinceMarch 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A1-P2A-mCherry
Plasmid#203859PurposeTet-inducible lentiviral plasmid expressing NR4A1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A1 (NR4A1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Mig P190 (Mig 185)
Plasmid#27483DepositorUseRetroviralTagsGFPExpressionMammalianMutationContains only exon 1 (e1) of bcr fused to ablPromoterAvailable sinceMarch 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
TFORF2718
Plasmid#142131PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertLRPPRC (LRPPRC Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3024
Plasmid#144500PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertHEY2 (HEY2 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A44_STOP
Plasmid#161208PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A44 (SLC25A44 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
FERMT1_pLX307
Plasmid#98333PurposeLentiviral expression of FERMT1DepositorInsertFERMT1 (FERMT1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterE1FaAvailable sinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF1506
Plasmid#143510PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertHEY2 (HEY2 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
GIV-F1685A FLAG
Plasmid#65948PurposeExpression GIV/Girdin F1685A mutation in Mammalian cellDepositorInsertGIV/Girdin (CCDC88A Human)
UseTags3xFlagExpressionMammalianMutationPhenylalanine 1685 to AlaninePromoterCMVAvailable sinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pL452(hygro)-Sf3b1-K700K
Plasmid#90426Purposeselectable HDR vector to introduce silent mutation (position 700) in mus Sf3b1 gene (for use with pL452-Sf3b1-K700E and sgSf3b1(T1) gRNA vectors enabling generation of hemizygous K700E mutation)DepositorInsertSf3b1 - left and right homology arms (Sf3b1 Mouse)
UseHomology-directed repair vectorTagsExpressionMutationPromoterAvailable sinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiSF3B1
Plasmid#202446PurposeExpression of a CRISPRi guide targeting SF3B1DepositorInsertSF3B1 gRNA (SF3B1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC22A7_STOP
Plasmid#161143PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC22A7 (SLC22A7 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorInsertMultiplex Nr4a1 gRNA 1 and 2 (Nr4a1 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationPromoterhU6Available sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC46A3_STOP
Plasmid#161381PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC46A3 (SLC46A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Anti-TrpC1 [1F1R]
Plasmid#177437PurposeMammalian Expression Plasmid of anti-TrpC1 (Human). Derived from hybridoma 1F1.DepositorInsertanti-TrpC1 (Homo sapiens) recombinant mouse monoclonal antibody (TRPC1 Mouse)
UseTagsExpressionMammalianMutationPromoterDual CMVAvailable sinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_OMA1_WT
Plasmid#81889PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorInsertOMA1 (OMA1 Human)
UseGateway entry vectorTagsExpressionMutationWTPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC1A7_STOP
Plasmid#161164PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC1A7 (SLC1A7 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBridge-tyrosinase.σ1A
Plasmid#197381PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-1 σ1A
UseTagsGAL4-DNA binding domain fragment, HA tag, and SV4…ExpressionYeastMutationContains an extra 42 nucleotides encoding 14 resi…PromoterADH1 and MET25Available sinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC16A10_STOP
Plasmid#161112PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC16A10 (SLC16A10 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MSCV-HA-Nr4a1-AA
Plasmid#160942PurposeGeneration of retrovirus for the overexpression of Nr4a1 mutant (287C 288EAA)DepositorInsertNr4a1 (Nr4a1 Mouse)
UseRetroviralTagsHA tagExpressionMammalianMutationChange Cys 287 Glu 288 into Ala AlaPromoterMSCV-LTRAvailable sinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC26A8_STOP
Plasmid#161443PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC26A8 (SLC26A8 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221_SLC25A25
Plasmid#131992PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC25A25 (SLC25A25 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223_OMA1_p.P177S
Plasmid#81441PurposeGateway Donor vector containing OMA1 , part of the Target Accelerator Plasmid Collection.DepositorInsertOMA1 (OMA1 Human)
UseGateway entry vectorTagsExpressionMutationP177SPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorInsertLMNA (Lam) (LMNA Human)
UseTagsExpressionYeastMutationPromoterT7Available sinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC25A34_STOP
Plasmid#161171PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC25A34 (SLC25A34 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 21, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
FGGY gRNA (BRDN0001145631)
Plasmid#77109Purpose3rd generation lentiviral gRNA plasmid targeting human FGGYDepositorInsertFGGY (FGGY Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATR gRNA (BRDN0001144763)
Plasmid#77549Purpose3rd generation lentiviral gRNA plasmid targeting human ATRDepositorInsertATR (ATR Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only