We narrowed to 18,605 results for: RAN-1
-
Plasmid#143650PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF1919
Plasmid#141887PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3224
Plasmid#144700PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1514
Plasmid#141830PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1689
Plasmid#143837PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1136
Plasmid#144080PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0053
Plasmid#141498PurposeLentiviral vector for overexpressing the MAZ transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1690
Plasmid#143967PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1137
Plasmid#143094PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1139
Plasmid#143932PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1138
Plasmid#144081PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0052
Plasmid#141497PurposeLentiviral vector for overexpressing the MAZ transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-KIF5A delta Tail
Plasmid#166955PurposeExpresses FLAG-tagged KIF5A protein (1-820aa) in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF2078
Plasmid#141910PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1442
Plasmid#143274PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1441
Plasmid#143273PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1849
Plasmid#143326PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1848
Plasmid#142869PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2080
Plasmid#141912PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Myc-KLC1 delta Tail
Plasmid#166965PurposeExpresses Myc-tagged KLC1 protein (1-495 aa) in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ889
Plasmid#84826PurposeMinimos transposon with Psmu-1:smu-1:GFP:smu-1 UTR and cbr-unc-119 selectionDepositorAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mucolipin1 D471-472K-pHcRed C1
Plasmid#62961Purposefull length human Mucolipin-1 D471/472K cloned into pHcRed1 C1DepositorInsertMucolipin-1 (MCOLN1 Human)
UseTagsHcRedExpressionMammalianMutationD471/472K (and two silent mutations T77 ACA inst…PromoterCMVAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+8 Flag3HuR
Plasmid#135950PurposeExpresses HuR in mammalian cells. Can also be used to generate mRNA for zebrafish expression.DepositorInsertELAV like RNA binding protein 1 (ELAVL1 Human)
UseTagsFlag3ExpressionMammalianMutationPromoterCMVAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
mCherry-TMCC1
Plasmid#120932PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTagsmCherryExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
3XFlag-TMCC1
Plasmid#121045PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTags3x-FlagExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-TMCC1
Plasmid#120931PurposeExpresses human TMCC1 in mammalian cellsDepositorInsertTrans membrane and coiled coil domain containing protein 1 (TMCC1 Human)
UseTagsGFPExpressionMammalianMutationPromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::lite-1G::SL2::his-24::tagBFP
Plasmid#232610PurposePan-neuronal expression of 'LITE-1' using a genomic fragment and fluorophore 'tagBFP', regulated by rab-3 promoter and unc-54 3' UTRDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
UseTagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCPromoterAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRS6E1b-luc(-732/-721) mutant 4
Plasmid#45387DepositorInsert6 copies of hPAI-1 promoter -732/-721 four point mutation (SERPINE1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationmutated from agacaaggttgt to acactaggatgaPromoterAvailable SinceJune 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pV92.2
Plasmid#78409PurposepKT230 plasmid engineered with the RTCas1v2-GFP cassette (RT-Cas1, Cas2, GFP) driven by the MMB-1 16S rRNA promoter, the CRISPR03 array driven by its native leader, and the tmRNA::td intron constructDepositorInsertsRT-Cas1
Cas2
UseTagsExpressionMutationPromoterAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALFY-FYVE 1G
Plasmid#197045PurposeExpression plasmid for the FYVE domain from ALFY for recombinant expression in E. coli.DepositorAvailable SinceDec. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0121
Plasmid#177053PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of iridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus driven by 35S promoterDepositorInsertiridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0117
Plasmid#177049PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of iridoid synthase (CrISY) from Catharanthus roseus driven by 35S promoterDepositorInsertiridoid synthase (CrISY) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0108
Plasmid#177041PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of geranyl pyrophosphate synthase (PaGPPS1) from Picea abies driven by 35S promoterDepositorInsertgeranyl pyrophosphate synthase (PaGPPS1) from Picea abies
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0911
Plasmid#177067PurposeMoClo Level 1, position 5, transcriptional unit for transient expression of loganic acid O-methyltransferase (MsLAMT) from Mitragyna speciosa driven by 35S promoterDepositorInsertloganic acid O-methyltransferase (MsLAMT) from Mitragyna speciosa
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0771
Plasmid#177061PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of secologanin synthase (CrSLS1) from Catharanthus roseus driven by 35S promoterDepositorInsertsecologanin synthase (CrSLS1) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0775
Plasmid#177065PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of strictosidine synthase (CrSTR) from Catharanthus roseus driven by 35S promoterDepositorInsertstrictosidine synthase (CrSTR) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAWH-IRP
Plasmid#133896PurposePositive control when used with pMS22H-IRE. Expression of Gal4AD-IRP hybrid protein. Homology regions for recombination with pMS22HDepositorInsertIRP
UseTagsExpressionYeastMutationPromoterT7Available SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-Stx3-L77A/L80A
Plasmid#100273PurposeExpresses GST-Stx3-L77A/L80A in bacteria.DepositorInsertStx3-1-265-L77A/L80A (Stx3 Rat)
UseTagsGSTExpressionBacterialMutationNo transmembrane domain; residues 4-264 present, …PromoterTacAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-Stx3-E78A/E83A
Plasmid#100272PurposeExpresses GST-Stx3-E78A/E83A in bacteria.DepositorInsertStx3-1-265-E78A/E83A (Stx3 Rat)
UseTagsGSTExpressionBacterialMutationNo transmembrane domain; residues 4-264 present, …PromoterTacAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-Stx3-LE165/166AA
Plasmid#100271PurposeExpresses GST-tagged open-conformation mutant of Stx3 in bacteria.DepositorInsertStx3-1-265-LE165/166AA (Stx3 Rat)
UseTagsGSTExpressionBacterialMutationNo transmembrane domain; residues 4-264 present, …PromotertacAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/GFP4_Seq1.3
Plasmid#206136PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/shCol1a1/Scarlet_Seq1.3
Plasmid#206137PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7[mRNA]-5'UTR:mMyod1[NM_010866.2]: Hba-a1_3'UTR
Plasmid#205026PurposeIn vitro transcription vector for production of synthetic mRNA encoding for mouse Myod1DepositorInsertMyod1 (Myod1 Mouse)
UseSynthetic Biology; In vitro transcription vector …TagsExpressionMutationPromoterAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_DUM1H01
Plasmid#71090PurposeGateway entry cloneDepositorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0109
Plasmid#177042PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of geranyl pyrophosphate synthase (PaGPPS1) from Picea abies driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertgeranyl pyrophosphate synthase (PaGPPS1) from Picea abies
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0776
Plasmid#177066PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of strictosidine synthase (CrSTR) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertstrictosidine synthase (CrSTR) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0772
Plasmid#177062PurposeMoClo Level 1, position 6, transcriptional unit for transient expression of secologanin synthase (CrSLS1) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertsecologanin synthase (CrSLS1) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD1CB0122
Plasmid#177054PurposeMoClo Level 1, position 2, transcriptional unit for transient expression of iridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus driven by 35S promoter; contains a chloroplast transit peptideDepositorInsertiridoid oxidase; CYP76A26 (CrIO) from Catharanthus roseus
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTracer_Cr-TRP1
Plasmid#64881PurposeExpresses CrTRP1 in mammalian cellsDepositorInsertTransient receptor potential 1
UseTagseGFPExpressionMutationPromoterCMVAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only