We narrowed to 7,507 results for: val
-
Plasmid#229996PurposeExpresses anti-GFP PAGER(TF) (high sensitivity) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG2-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMAL-SH3(2)-5R
Plasmid#112089PurposeBacterial expression plasmid containing His and MBP tags for 5 repeats of the second SH3 domain from human NCK1.DepositorInsertSH3(2)-5R (NCK1 Human)
TagsHis6 and MBPExpressionBacterialMutationconstruct contains only repeats of the second SH3…PromoterLacAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV/myc/Nuc-hOGG1
Plasmid#18709DepositorAvailable SinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
-
pLPC-Flag-SOCS1
Plasmid#129514PurposeRetroviral vector for the expression of human SOCS1 with a FLAG tag in N-terminalDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-hfCas13d-pA
Plasmid#195864PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 Hepatitis C Virus NS3/NS4A
Plasmid#61696Purposeinducible dual expression of NS3 protease along with its cofactor NS4ADepositorInsertsNS4A
NS3
TagshisExpressionBacterialPromoterT7Available SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
JpExpress404 PTEN-LONG
Plasmid#49417PurposeBacterial Expression VectorDepositorAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER-21-SPI1
Plasmid#97039PurposeExpresses SPI1 in mammalian cellsDepositorAvailable SinceSept. 5, 2017AvailabilityAcademic Institutions and Nonprofits only