We narrowed to 12,359 results for: NSI
-
Plasmid#85491PurposeFirefly luciferase under the control of ATP5O 5'UTR followed by a stem-loopDepositorInsert5'UTR of ATP5O followed by stem loop (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianAvailable SinceJan. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 ATP5O(TISU)-FF
Plasmid#85489PurposeFirefly luciferase under the control of ATP5O TISUDepositorInsertFull TISU element of ATP5O (ATP5PO Human)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutation2nd and 3rd codon of luciferase were modified fro…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-RAP2A-N17-neo
Plasmid#156179PurposeLentiviral vector for expression of RAP2A-N17, with neomycin selectionDepositorInsertRAP2A (RAP2A Human)
UseLentiviralExpressionMammalianMutationchanged Serine 17 to AsparaginePromoterhuman PGKAvailable SinceJuly 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 S 24nt-del
Plasmid#153952PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 23, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 S 24nt-del_nostop
Plasmid#153953PurposeGateway-compatible Entry vector, with insert of S CDS bearing a 24nt deletion from SARS-CoV-2 genomic analysis in Davidson et al. 2020DepositorInsertS (S SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO_NWS.V5.VSVg_NGFR
Plasmid#158246PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.FLAG.VSVg_NGFR
Plasmid#158247PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.V5.FLAG_NGFR
Plasmid#158251PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsNWS.V5.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 - myc ULK1 k46I
Plasmid#27624DepositorInsertmouse myc ULK1 K46I (Myc Mouse)
UseGateway donr vectorTagsmycMutationInitial M from ULK1 removed. Silent mutation at A…Available SinceFeb. 18, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO_S.V5.HA_NGFR
Plasmid#158339PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsS.V5.HAMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.AU1.C_NGFR
Plasmid#158314PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsOllas.AU1.CMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7a (closed)
Plasmid#160101PurposeExpresses murine Fbxw7 alpha in mammalian cellsDepositorAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HES3
Plasmid#101411PurposeDonor Vector containing HES3 transcription factor, part of the Human TFome CollectionDepositorInsertHES3 (HES3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 - myc ULK1 4SA
Plasmid#27625DepositorInsertmouse myc ULK1 4SA (Myc Mouse)
UseGateway donr vectorTagsmycMutationS467A, S555A, T574A, S637A. Initial M from ULK1 r…Available SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 ORF7B C-trunc_nostop
Plasmid#153956PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 11, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR223 SARS-CoV-2 ORF7B C-trunc
Plasmid#153957PurposeGateway-compatible Entry vector, with insert of truncated ORF7B CDS from SARS-CoV-2 genomic analysis in Kim et al. 2020DepositorInsertORF7B (ORF7b SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway-compatible entry vectorMutationMany synonymous changes due to codon optimizationAvailable SinceJune 9, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
BRI1 BRI1_pECIA2
Plasmid#115086PurposeBait vector BRI1 BRI1_pECIA2 should be used with prey vector BRI1 BRI1_pECIA14.DepositorInsertAT4G39400 (BRI1 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
IMPT-10917
Plasmid#236192PurposeExpress GPR6 in insect cellsDepositorAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only