-
Plasmid#114604PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P90C
Plasmid#114603PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
UseTagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…PromoterAvailable sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BKV ER
Plasmid#37864DepositorUseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
UseTagsExpressionYeastMutationPromoterAlcohol OxidaseAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FUW-C-prM-E-NS1
Plasmid#175281Purposelentiviral vector mediating bicistronic expression of the 4 genes of YFV-17D (C-prM-E-NS1) and EGFP.DepositorInsertC-prM-E-NS1 and EGFP (POLY Yellow fever virus strain 17D)
UseLentiviralTagsIRES EGFPExpressionMutationPromoterhuman ubiquitin CAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-NS1
Plasmid#175276PurposeAAV vector mediating bicistronic expression of NS1 gene of YFV-17D and dTomato with NLSDepositorInsertNonstructural protein 1 (NS1) of YFV-17D; NLS-dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsNLS-dTomato (P2A cleavage)ExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-NS1
Plasmid#175273PurposeAAV vector mediating Cre-depenent expression of NS1 gene of YFV-17DDepositorInsertNonstructural protein 1 (NS1) of YFV-17D (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromoterSynapsinAvailable sinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1NF
Plasmid#175279PurposeAAV vector mediating inducible expression of the NS1 gene of YFV-17DDepositorInsertNS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10873
Plasmid#183961PurposeU6-SKSKSO(crRNA array)-CAG-hyperdCas12a-HA-miniVPRDepositorInsertsHyperdCas12a
poly-crRNA array targeting Sox2-Klf4-Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-NS1-dTomato
Plasmid#175278PurposeAAV vector mediating inducible bicistronic expression of NS1 gene of YFV-17D and dTomatoDepositorInsertNS1; dTomato (POLY Yellow fever virus strain 17D)
UseAAVTagsdTomato (from bidirectional promoter)ExpressionMutationPromoterbidirectional TRE promoterAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-C-prM-E-NS1
Plasmid#175277PurposeAAV vector mediating inducible expression of 4 genes (the C-prM-E-NS1) of YFV-17DDepositorInsertC-prM-E-NS1 (POLY Yellow fever virus strain 17D)
UseAAVTagsExpressionMutationPromotertight TREAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_D770A-mCherry
Plasmid#192260PurposeExpresses PARP1 D770A mutant in mammalian cells. Tagged with mCherry.DepositorInsertPARP1_D770A (PARP1 Human)
UseTagsmCherryExpressionMammalianMutationD770APromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PARP1_R878A-mCherry
Plasmid#192261PurposeExpresses PARP1 R878A mutant in mammalian cells. Tagged with mCherry.DepositorInsertPARP1_R878A (PARP1 Human)
UseTagsmCherryExpressionMammalianMutationR878APromoterCMVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniExpressionMutationdead Cas9PromoterAvailable sinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF1953
Plasmid#142897PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorInsertPARP1 (PARP1 Human)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1aAvailable sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPK
Plasmid#38334DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
UseTags6xHIS, MBP, and TEVExpressionBacterialMutationPromoterT7Available sinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPK
Plasmid#38333DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
UseTags6xHIS, GST, and TEVExpressionBacterialMutationPromoterT7Available sinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDKIER
Plasmid#37093DepositorUseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.cLT206.V5(CM2B4)
Plasmid#28189DepositorInsertMCPyV Large T antigen (206 wild-type strain)
UseTagsV5ExpressionBacterial and MammalianMutationPromoterAvailable sinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.LT206.V5(CM2B4)
Plasmid#28190DepositorInsertMCPyV genomic T antigen locus (206 wild-type strain)
UseTagsV5ExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pOpen-BstpolLF
Plasmid#165553PurposeFragment retains 5'-3' polymerase activity from full length Bst DNA Polymerase, while lacking 5'-3' exonuclease activity. Suitable for applications requiring thermophilic strand displacement.DepositorInsertBst DNA Polymerase, Large Fragment
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 16, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
mP_ILB_Vector 1
Plasmid#232193PurposeThe plasmid vector designed for the expression of four genes in oleaginous yeasts, including Yarrowia lipolytica and Rhodotorula toruloides.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceMarch 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOpen-phi29pol
Plasmid#165573PurposeDNA polymerase responsible for protein-primed viral DNA replication by strand displacement with high processivity and fidelity. Possesses three enzymatic activities: DNA synthesis (polymerase), primer terminal protein (TP) deoxynucleotidylation, and 3' to 5' exonuclease activity.DepositorInsertphi29 DNA Polymerase
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pST44
Plasmid#64007Purposepolycistronic cloning vector for pST44 plasmid suiteDepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST39
Plasmid#64009Purposeoriginal polycistronic cloning vector for plasmid suite (generation I)DepositorTypeEmpty backboneUseTagsExpressionBacterialMutationPromoterT7Available sinceNov. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOpen-GBDpol (exo)
Plasmid#165572PurposeRobust and extremely thermostable polymerase with a half-life of 23 hours at 95 degrees C; offers 5x higher fidelity than Taq and robust performance. Ideal for GC-rich or looped sequences. Lacks exonuclease activity. Comparable to Deep Vent (exo-) DNA Polymerase at NEBDepositorInsertPyrococcus Sp. Heat-Stable (exo-) DNA Polymerase
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 24, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Pig3 Promoter
Plasmid#16489DepositorInsertPIG3 promoter (TP53I3 Human)
UseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLS406
Plasmid#231078PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker URA3DepositorTypeEmpty backboneUseIntegratingTagsExpressionBacterial and YeastMutationPromoterAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLS405
Plasmid#231077PurposeMinimal integrating shuttle vector depleted of restriction sites outside the polylinker region, yeast selection marker LEU2DepositorTypeEmpty backboneUseIntegratingTagsExpressionBacterial and YeastMutationPromoterAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only