We narrowed to 15,910 results for: grna
-
Plasmid#99887PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
pAK-EL-01
Plasmid#125760PurposeEndlinker for tRNA-gRNA system when using only one guideDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK-EL-04
Plasmid#125763PurposeEndlinker for tRNA-gRNA system when using only four guidesDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK-EL-05
Plasmid#125764PurposeEndlinker for tRNA-gRNA system when using only five guidesDepositorInsertEndlinker
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pWT016i
Plasmid#96856Purposetheophylline-agRNA-GFPDepositorInserttheophylline-agRNA-GFP
ExpressionMammalianAvailable sinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-Trono-EFS-Blast-P2A-TurboRFP
Plasmid#228893PurposeCloning and expression of gRNAs or pegRNAs with EcoRI/Esp3I insertion.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable sinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-BsaI_pJMP2776
Plasmid#208890PurposeAcinetobacter baumannii CRISPRi plasmid for cloning new guides (BsaI cloning site in gRNA cassette).DepositorInsertdCas9, sgRNA expression cassette
ExpressionBacterialAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMM117
Plasmid#127212PurposeBeYDV replicon with constitutive Luc expression, sgRNA targeting PDSDepositorInsertLuc, sgRNA
ExpressionPlantMutationcodon optimized CDSsAvailable sinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd g4+g10+g18 (FWA)
Plasmid#115487PurposeCRISPR Cas9 SunTag system to target NtDRMcd to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133D
Plasmid#69289PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ146-ZmUbi-tRNA
Plasmid#158404PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ136-tRNA2.0; assembly of 6 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available sinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX335-EN477
Plasmid#86232PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN475.DepositorInsertspCas9-nickase and sgRNA against mouse CTCF STOP Codon
UseMouse TargetingExpressionMammalianAvailable sinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 Ctnnb1.2
Plasmid#59912PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable sinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide2
Plasmid#118159PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA2 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118160PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH1v1
Plasmid#60244PurposegRNA expression by the H1 promoterDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterH1 promoterAvailable sinceOct. 6, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo sgTREX1
Plasmid#127645PurposeKnock-out of human TREX1 with NeoRDepositorInsertTREX1 sgRNA (TREX1 Human)
UseLentiviralAvailable sinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133A2.0
Plasmid#99891PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available sinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426*-SpSgH
Plasmid#136993PurposeHelper plasmid for SpCas9 gRNA cloning and expressionDepositorTypeEmpty backboneExpressionYeastPromoterSNR52Available sinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only