We narrowed to 15,742 results for: grna
-
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CSNK1A1 gRNA (BRDN0001145680)
Plasmid#76189Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1A1DepositorInsertCSNK1A1 (CSNK1A1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001147303)
Plasmid#76892Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorInsertPIKFYVE (PIKFYVE Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149021)
Plasmid#77864Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorInsertPRKDC (PRKDC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-ECT2_sgRNA
Plasmid#183873PurposepX459V2.0-HypaCas9 plasmid with ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#1
Plasmid#189987PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CD2 gRNA (BRDN0001146864)
Plasmid#75827Purpose3rd generation lentiviral gRNA plasmid targeting human CD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149438)
Plasmid#77863Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorInsertPRKDC (PRKDC Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_SRD5A3-EGFP
Plasmid#159781PurposeS. pyogenes pegRNA for C to A mutation at the SRD5A3 site of human cells using prime editingDepositorInsertspacer of pegRNA targeting SRD5A3 gene (SRD5A3 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001146969)
Plasmid#77982Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Elf5 gRNA
Plasmid#128836PurposegRNA for targeting mouse Elf5 loci using CRISPR-cas techniqueDepositorAvailable SinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-non-target
Plasmid#129465PurposeDerived from pSCB2-sgRNA. 20 nucleotide sequence added as sgRNA binding region by inverse PCR. Used as a negative control.DepositorInsertNon-target/random gRNA
UseCRISPRTagsExpressionBacterialMutationPromoterBBa_J23119 (SpeI)Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
CHEK1 C1.2 gRNA
Plasmid#90626Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK1DepositorInsertCHEK1 (Guide Designation C1.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA1
Plasmid#134635Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorAvailable SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
PPP2R2B B6.5 gRNA
Plasmid#90848Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R2BDepositorInsertPPP2R2B (Guide Designation B6.5)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
EGFR gRNA (BRDN0001146570)
Plasmid#75688Purpose3rd generation lentiviral gRNA plasmid targeting human EGFRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA2
Plasmid#180371Purposetargeting mouse Skil/SnoN geneDepositorInsertSkil targeting gRNA (Skil Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterhuman U6Available SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
TRIM28 gRNA (BRDN0001162440)
Plasmid#76140Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM28DepositorInsertTRIM28 (TRIM28 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Spy EMX1-pegRNA
Plasmid#169855PurposeSpyCas9-pegRNA for EMX1DepositorInsertSpy EMX1-pegRNA
UseTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
BRD2 gRNA (BRDN0001487068)
Plasmid#77983Purpose3rd generation lentiviral gRNA plasmid targeting human BRD2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA3_GAL4UAS-Luciferase reporter
Plasmid#64159PurposePhotoactivatable transcription system. Lentiviral expression of sgRNA3 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassetteDepositorInsertsgRNA3 for GAL4UAS-Luciferase reporter
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147151)
Plasmid#76461Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorInsertPFKFB3 (PFKFB3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB3 gRNA (BRDN0001147212)
Plasmid#76463Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorInsertPFKFB3 (PFKFB3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK3 gRNA (BRDN0001149014)
Plasmid#75966Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK3DepositorInsertMAPK3 (MAPK3 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only