We narrowed to 2,739 results for: SAB
-
Plasmid#55707PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta1. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal s produced.DepositorInsertmCer(1-158)-beta 1 (GNB1 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55778PurposeA carboxyl-terminal mCerulean fragment was fused to Gbeta-5. When co-expressed with an amino terminal mCerulean fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCer(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
TagsmCer(159-238) was fused to the amino terminus of …ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-45: TTN-mEGFP
Plasmid#114412PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TTN, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertTTN Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (TTN Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCag SE (Self-excising) FlpO-2A-Cre EV
Plasmid#130986Purposeepisomal expression of FlpO and Cre recombinases, self excisingDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianMutationprotamine intron added to FlpO to prevent bacteri…PromoterCMV/Chick β-actin (CAG)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-CFP
Plasmid#55793PurposeG protein alpha-s internally tagged with ECFP and EE epitopeDepositorInsertG-alpha-s-EE-ECFP (Gnas Rat)
TagsECFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationHis was substituted for Asn164 in ECFP (Clontech)…PromoterCMVAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-GFP
Plasmid#66083PurposeG protein alpha-s internally tagged with EGFP and EE epitopeDepositorInsertG-alpha-s-EE-EGFP (Gnas Rat)
TagsEGFP flanked by SGGGS on each side was inserted i…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#55777PurposeA C-terminal CFP fragment was fused to Ggamma-2. When co-expressed with an N-terminal mCerulean, CFP, or YFP fragment fused to a Gbeta subunit with which it interacts a fluorescent signal is produced.DepositorInsertCFP(159-238)-gamma-2 (GNG2 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-o-YFP
Plasmid#55776PurposeThis G protein alpha-o construct contains internal insertions of YFP and the EE epitopeDepositorInsertG protein alpha-o internally tagged with EYFP and EE epitope (Gnao1 Rat)
TagsEE epitope was introduced internally with D167E a…ExpressionMammalianMutationA BglII site was removed from the 5' untrans…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCherry
Plasmid#66968PurposeG protein alpha-s internally tagged with mCherry and EE epitopeDepositorInsertG-alpha-s-EE-mCherry (Gnas Rat, Discosoma sp.)
Tagsinternal EE epitope (residues 189-194 in alpha- s…ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55763PurposeA carboxyl-terminal CFP fragment was fused to Gbeta-5. When co-expressed with an amino terminal CFP or YFP fragment fused to a Ggamma subunit or RGS7, a fluorescent signal is produced.DepositorInsertCFP(159-238)-beta-5 (GNB5 Human, Aequorea victoria)
TagsCFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationCFP(159-238) includes a substitution of His for A…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-2 in pcDNAI/Amp
Plasmid#54472PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-2. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma -2 (GNG2 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-3XFlag (cyto) WPRE
Plasmid#129421PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of a TagBFP2-3XFlag cytoplasmic reporter proteinDepositorInsertTagBFP2-3Flag
UseMosaic analysis for dual recombinase-mediated cas…Tags3X Flag epitope tagPromoternone (3X polyA to mitigate episomal expression)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-1 in pcDNAI/Amp
Plasmid#54471PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-1. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-1 (GNGT1 Bovine, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-gamma-5 in pcDNAI/Amp
Plasmid#55625PurposeAn amino-terminal mCerulean fragment was fused to Ggamma-5. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCer(1-158)-gamma-5 (GNG5 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-5 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s-mCerulean
Plasmid#66084PurposeG protein alpha-s internally tagged with mCerulean and EE epitopeDepositorInsertG-alpha-s-EE-mCerulean (Gnas Rat, Aequorea victoria)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationBamHI sites in the alpha-s cDNA were removed and …PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-7 in pcDNAI/Amp
Plasmid#54473PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-7. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-7 (GNG7 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-7 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-1 in pcDNAI/Amp
Plasmid#55615PurposeAn amino-terminal CFP fragment was fused to Ggamma-1. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP(1-158)-gamma-1 (GNGT1 Bovine, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-1 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
CFP(1-158)-gamma-2 in pcDNAI/Amp
Plasmid#55616PurposeAn amino-terminal CFP fragment was fused to Ggamma-2. When co-expressed with a carboxyl-terminal CFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertCFP (1-158)-gamma-2 (Gng2 Mouse, Aequorea victoria)
TagsCFP(1-158) was fused to the amino terminus of Gga…ExpressionMammalianMutationGgamma-2 was amplified by PCR, which added a BamH…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-10 in pcDNAI/Amp
Plasmid#55192PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-10. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP-(159-238)-gamma-10 (GNG10 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-10 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
YFP(159-238)-gamma-12 in pcDNAI/Amp
Plasmid#55194PurposeA carboxyl-terminal YFP fragment was fused to Ggamma-12. When co-expressed with an amino-terminal YFP fragment fused to a Gbeta subunit with which it interacts, a fluorescent signal is produced.DepositorInsertYFP(159-238)-gamma-12 (GNG12 Human, Aequorea victoria)
TagsYFP(159-238) was fused to the amino terminus of G…ExpressionMammalianMutationGgamma-12 was amplified by PCR, which added a Bam…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X K181E
Plasmid#225714PurposeBacterial expression of USP27X (K181E) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro 3XFLAG-hATXN7L3
Plasmid#225725PurposeTransfection of ATXN7L3 with 3XFLAG tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X S404N
Plasmid#225724PurposeTransfection of USP27X (S404N) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y381H
Plasmid#225723PurposeTransfection of USP27X (Y381H) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X F313V
Plasmid#225722PurposeTransfection of USP27X (F313V) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X K181E
Plasmid#225721PurposeTransfection of USP27X (K181E) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y144C
Plasmid#225720PurposeTransfection of USP27X (Y144C) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X G76S
Plasmid#225719PurposeTransfection of USP27X (G76S) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X S404N
Plasmid#225717PurposeBacterial expression of USP27X (S404N) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X Y381H
Plasmid#225716PurposeBacterial expression of USP27X (Y381H) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X F313V
Plasmid#225715PurposeBacterial expression of USP27X (F313V) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X Y144C
Plasmid#225713PurposeBacterial expression of USP27X (Y144C) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X G76S
Plasmid#225712PurposeBacterial expression of USP27X (G76S) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X C87A
Plasmid#225711PurposeBacterial expression of USP27X (C87A) with GST tagDepositorInsertUSP27X C87A (USP27X Human)
TagsGSTExpressionBacterialMutationC87A, inactivates deubiquitylaseAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only