We narrowed to 14,068 results for: crispr grnas
-
Plasmid#99897PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ141D2.0
Plasmid#99906PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTC217
Plasmid#70018PurposeCas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1bDepositorInsertNuclease (Cas9/sgRNA) + Donor + GVR
UseCRISPRExpressionPlantAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a8
Plasmid#124848PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCE38
Plasmid#174432PurposeC. auris LEUpOUT HYG marker CAS9 expression construct. Use with pCE41 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, HYG 1 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTC223
Plasmid#70019PurposeCas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 7DepositorInsertNuclease (Cas9/sgRNA) + Donor + GVR
UseCRISPRExpressionPlantAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT10
Plasmid#223382PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP16_Lenti Scramble Control
Plasmid#239417PurposeNegative control Lentiviral plasmid for SpCas9-based CRISPR KODepositorInsertScramble sequence
UseLentiviralAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREDIT_Cas9-MS2-BB_BbsI
Plasmid#164802PurposeREDIT backbone for wildtype Cas9, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9-T2A-EBFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc18a2
Plasmid#124849PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-TJP1
Plasmid#227299PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of TJP1 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc18a2
Plasmid#124862PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT11
Plasmid#223383PurposeT-DNA vector for SpRY mediated mutagenesis for monocot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT08
Plasmid#223380PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAC1821_pCR8-SMN2-DN-RG6-SA
Plasmid#118655PurposeTransient transfection; Expressed DR-SMN2-DN-RG6-SA-DR CasRx polycistronic gRNA with 3 spacers targeting SMN2 intron and 1 spacer targeting RG6 splice acceptor; Gateway DonorDepositorInsertSMN2-DN-RG6-SA
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141A2.0
Plasmid#99896PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only