We narrowed to 4,431 results for: chm
-
Plasmid#104598PurposeExpresses C-terminal 366-453 residues of CHMP7 with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-12DepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCA528 CHMP3 159-222
Plasmid#104599PurposeExpresses C-terminal 159-222 residues of CHMP3 with non-native N-term cysteine for fluorescent labeling; Internal ID: WISP18-5DepositorInsertCHMP3 residues 159-222 (CHMP3 Human)
TagsHis-SUMOExpressionBacterialMutationContains nonnative Gly-Cys for fluorescent labeli…PromoterT7Available SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP4B-mut-NS3-Green
Plasmid#223531PurposeMammalian expression of CHMP4B fused to the hepatitis C virus protease NS3 through a short linker containing mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP4B (CHMP4B Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP3-mut-NS3-Green
Plasmid#223530PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-mut-NS3-Green
Plasmid#223529PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing a mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-CHMP1B, S2C
Plasmid#184803PurposeBacterial expression of CHMP1B (S2C mutation)DepositorAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-178
Plasmid#108284PurposeExpresses residues 4-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-279DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationdeleted amino acids 1-3 and 179-199Available SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-CHMP3(147)-HA
Plasmid#154177Purposeexpresses mouse CHMP3(147) in mammalian cellsDepositorInsertCHMP3 (Chmp3 Mouse)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 147PromoterEF1alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLNCX2-mCherry-CHMP2B-siRNAres
Plasmid#115333Purposeexpresses siRNA-resistant mCherry-CHMP2B in mammalian cellsDepositorInsertCHMP2B (CHMP2B Human)
UseRetroviralTagsmCherryExpressionMammalianMutationmutated to be resistant to siRNA knockdownPromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-OSF-PP-human-CHMP3(150)
Plasmid#154181Purposeexpresses human CHMP3(150) in mammalian cellsDepositorInsertCHMP3 (CHMP3 Human)
TagsFLAG and Strep-Tag IIExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 150PromoterCAGAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP2B-201-213
Plasmid#232016PurposeExpression of the CHMP2B VPS4-binding region attached to sfGFP.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
GST-CHMP4A (1-204) (pGEX2T(TEV))
Plasmid#80632PurposeResidues 1-204 of CHMP4A; Bacterial Expression vector; TEV-cleavable GST tag; Sundquist Lab internal ID: WISP06-198DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-mouse-full-length-CHMP3-HA
Plasmid#154176Purposeexpresses mouse CHMP3 in mammalian cellsDepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-squirrel-monkey-CHMP3(155)-HA
Plasmid#154173Purposeexpresses squirrel monkey CHMP3(155) in mammalian cellsDepositorInsertCHMP3(155)
TagsHAExpressionMammalianMutationC-terminal truncation of CHMP3 at amino acid 155PromoterEF1-alphaAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-owl-monkey-retroCHMP3(148)-HA
Plasmid#154252Purposeexpresses prematurely truncated owl monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CHMP2A-myc, L216D/L219D
Plasmid#180645PurposeMammalian expression of CHMP2A with L216D/L219D mutations. Has C-terminal Myc tag. Internal ID:WISP20-13.DepositorAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-woolly-monkey-retroCHMP3(148)-HA
Plasmid#154250Purposeexpresses prematurely truncated woolly monkey retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF1α-pygmy-marmoset-retroCHMP3(148)-HA
Plasmid#154251Purposeexpresses prematurely truncated pygmy marmoset retroCHMP3 in mammalian cellsDepositorInsertretroCHMP3
TagsHAExpressionMammalianMutationC-terminal truncation of retroCHMP3 at amino acid…PromoterEF1-alphaAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only