We narrowed to 4,522 results for: GCA;
-
Plasmid#75965Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
STK16 gRNA (BRDN0001145107)
Plasmid#75935Purpose3rd generation lentiviral gRNA plasmid targeting human STK16DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001145731)
Plasmid#75533Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA6 gRNA (BRDN0001147018)
Plasmid#75535Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STRADB gRNA (BRDN0001148940)
Plasmid#75496Purpose3rd generation lentiviral gRNA plasmid targeting human STRADBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-puro/hFOXH1 shRNA6
Plasmid#59310PurposeKnockdown of human FOXH1DepositorAvailable SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-super TEV protease
Plasmid#171782PurposeExpresses Maltose-binding protein-super TEV protease in bacterial cytoplasm. This protease version performs well in the absence of added reducing agent.DepositorInsertMBP-sTEV
TagsArg6 tag and Internal His6 tagExpressionBacterialMutationNo internal TEV cleavage site between the MBP and…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
TP53-KO_gRNA_2
Plasmid#195131PurposeTP53-targeting gRNA in the LRG2.1 backboneDepositorInsertTP53 KO gRNA 2 (TP53 Human)
ExpressionMammalianAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK2/PKR_sgRNA
Plasmid#218527PurposesgRNA targeting human EIF2AK2/PKRDepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4405
Plasmid#115466PurposeConstitutive lentiviral expressionDepositorAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shSNAI1
Plasmid#115467PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA3 gRNA (BRDN0001148452)
Plasmid#75943Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Nkx2-1*/Neo
Plasmid#31272DepositorInsertNkx2-1* (Nkx2-1 Mouse)
UseRetroviralExpressionMammalianMutationA shNkx2-1 insensitive Nkx2-1 cDNA was created by…Available SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
CAMKV gRNA (BRDN0001145768)
Plasmid#75526Purpose3rd generation lentiviral gRNA plasmid targeting human CAMKVDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FN3K gRNA (BRDN0001148047)
Plasmid#77433Purpose3rd generation lentiviral gRNA plasmid targeting human FN3KDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CCL2 gRNA (BRDN0001145563)
Plasmid#77866Purpose3rd generation lentiviral gRNA plasmid targeting human CCL2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_puro_FAM136A_sg1
Plasmid#244877PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR_blast_FAM136A_sg1
Plasmid#244875PurposeKnockout of human FAM136ADepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDG459-HNRNPD-KO
Plasmid#233287PurposeHNRNPD KnockoutDepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hXIAP_2b)-PGKpuro2ABFP-W
Plasmid#208421PurposeLentiviral gRNA plasmid targeting human XIAP gene, co-expression of BFP tagDepositorInsertXIAP (XIAP Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hMTOR_2b)-PGKpuro2ABFP-W
Plasmid#208430PurposeLentiviral gRNA plasmid targeting human MTOR gene, co-expression of BFP tagDepositorInsertMTOR (MTOR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-SpCas9_gRNA-OPA1-del_exon5-gRNA2b_(CJT93)
Plasmid#226992PurposepUC19 plasmid with U6 promoter and SpCas9 gRNA to create an OPA1-del_exon5 cell line via nuclease mediate excision, gRNA 2b must be used with gRNA 1a or 1bDepositorInsertSpCas9 gRNA 2b to create OPA1-del_exon5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(PDLIM1_5-1)-PGKpuroBFP-W
Plasmid#211978PurposeExpress gRNA against PDLIM1 with puro and BFPDepositorInsertsgRNA targeting PDLIM1 (PDLIM1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ENO1_sgRNA1
Plasmid#201592PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertENO1 (ENO1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 LIPT2-2
Plasmid#184483PurposeLentivirus gRNA targeting human LIPT2 geneDepositorInsertLIPT2 (LIPT2 Human)
UseLentiviralAvailable SinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
ADK gRNA (BRDN0001146410)
Plasmid#75743Purpose3rd generation lentiviral gRNA plasmid targeting human ADKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only