We narrowed to 6,763 results for: poly
-
Plasmid#174811PurposeBacterial expression of a hyperactive PARP1 CAT lacking the autoinhibitory HD subdomainDepositorInsertPARP1-CATdeltaHD (PARP1 Human)
Tags6xHisExpressionBacterialMutationResidues 678-787 replaced by eight-residue linker…Available SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-NS1
Plasmid#175273PurposeAAV vector mediating Cre-depenent expression of NS1 gene of YFV-17DDepositorInsertNonstructural protein 1 (NS1) of YFV-17D (POLY Yellow fever virus strain 17D)
UseAAVPromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-CAT-L713F
Plasmid#173944PurposeBacterial expression of isolated PARP1 CAT domain containing L713F gain-of-function mutationDepositorAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-L713F
Plasmid#174794PurposeBacterial expression of a hyperactive PARP1 mutant (L713F destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-C125G
Plasmid#174792PurposeBacterial expression of a less active PARP1 mutant (C125G reduces affinity for single-strand DNA break)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986H
Plasmid#174801PurposeBacterial expression of a PARP1 mutant that produces highly branched but short PAR chains overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-Y986S
Plasmid#174802PurposeBacterial expression of a PARP1 mutant that produces mainly short PAR oligomersDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G972R
Plasmid#174800PurposeBacterial expression of a PARP1 mutant that produces less PAR oligomers overallDepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delWGR-L713F
Plasmid#173941PurposeBacterial expression of PARP1 lacking WGR domain but containing L713F gain-of-function mutationDepositorInsertPARP1delWGR-L713F (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 521-660; L713F, V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A774L
Plasmid#174796PurposeBacterial expression of a hyperactive PARP1 mutant (A774L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-W318R
Plasmid#174793PurposeBacterial expression of an inactive PARP1 (W318R disrupts interdomain communication and HD subdomain unfolding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A762V
Plasmid#174795PurposeBacterial expression of wild type PARP1 mutant (A762V is reversion of the common V762A polymorphism)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn1-L713F
Plasmid#173937PurposeBacterial expression of PARP1 lacking Zn1 domain but containing L713F gain-of-function mutationDepositorInsertPARP1delZn1-L713F (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 1-96; L713F, V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1delZn3-L713F
Plasmid#173934PurposeBacterial expression of PARP1 lacking Zn3 domain but containing L713F gain-of-function mutationDepositorInsertPARP1delZn3-L713F (PARP1 Human)
Tags6xHisExpressionBacterialMutationDeletion of residues 214-373; L713F, V762AAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-G871L
Plasmid#174798PurposeBacterial expression of a hyperactive PARP1 mutant (G871L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-A870L
Plasmid#174797PurposeBacterial expression of a hyperactive PARP1 mutant (A870L destabilizes the autoinhibitory HD subdomain)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28_6xHis-PARP1-K893I
Plasmid#174799PurposeBacterial expression of an inactive mutant (K893I may disrupt NAD+ binding)DepositorAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHIPH4
Plasmid#117685PurposeHansenula polymorpha expression plasmidDepositorInsertAlcohol Oxidase promoter
ExpressionYeastPromoterAlcohol OxidaseAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pETM41-EcPPK
Plasmid#38334DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, MBP, and TEVExpressionBacterialPromoterT7Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pKM263-EcPPK
Plasmid#38333DepositorInsertE. coli polyphosphate kinase (ppk Escherichia coli)
Tags6xHIS, GST, and TEVExpressionBacterialPromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDKIER
Plasmid#37093DepositorExpressionMammalianPromoterCMVAvailable SinceJuly 3, 2012AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA2-MpCKB
Plasmid#238528PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKB
Plasmid#238527PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 betaDepositorInsertMpCKB
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
GE-0010-gRNA1-MpCKA
Plasmid#238526PurposePlant expression of Cas9 and gRNA against M. polymorpha CK2 alphaDepositorInsertMpCKA
UseCRISPRExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.cLT206.V5(CM2B4)
Plasmid#28189DepositorInsertMCPyV Large T antigen (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB-327-Ef1-MpCKA-WT-TagRFP
Plasmid#238529PurposePlant expression of wild-type M. polymorpha CK2 alpha, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.MCV.LT206.V5(CM2B4)
Plasmid#28190DepositorInsertMCPyV genomic T antigen locus (206 wild-type strain)
TagsV5ExpressionBacterial and MammalianAvailable SinceMay 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pOpen-BstpolLF
Plasmid#165553PurposeFragment retains 5'-3' polymerase activity from full length Bst DNA Polymerase, while lacking 5'-3' exonuclease activity. Suitable for applications requiring thermophilic strand displacement.DepositorInsertBst DNA Polymerase, Large Fragment
UseSynthetic BiologyAvailable SinceAug. 16, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMpGWB-327-Ef1-MpCKA-K151M-D258N-TagRFP
Plasmid#238530PurposePlant expression of M. polymorpha CK2 alpha K151M, D258N, tagged with TagRFP in plantsDepositorInsertMpCKA
TagsTagRFPExpressionPlantMutationK151M, D258NAvailable SinceJune 27, 2025AvailabilityAcademic Institutions and Nonprofits only