We narrowed to 4,446 results for: gca
-
Plasmid#170984PurposeEncodes sgRNA target 2300 and Kanamycin resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCSh3-2300
Plasmid#170985PurposeEncodes sgRNA target 2300 and Tetracycline resistance transposon.DepositorInsertSh-CAST sgRNA 2300
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119Available SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-tdTomato
Plasmid#44332DepositorHas ServiceAAV5InserttdTomato
UseAAV; Adeno-associated virus ()ExpressionMammalianAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-dCas9
Plasmid#125687PurposeGene knockdown for actinomycetesDepositorInsertstreptomyces codon optimized spdCas9, sgRNA casette
UseCRISPR and Synthetic BiologyPromoterermE*/tipAAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJYS2_crtYf
Plasmid#85544PurposeConstitutive transcription of crRNA of crtYf, Spectinomycin resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSWAP_Entry_T2
Plasmid#184864PurposepSwap plasmid part containing the T2 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSWAP_Entry_T1
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF1
Plasmid#117156PurposeTarget site TTGCTCTTAGCATCTCGGCTGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pALPS puro miR30-IRF7
Plasmid#117158PurposeTarget site ATAAGGAAGCACTCGATGTCGDepositorInsertshRNA targeting miR30
UseLentiviralAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATG16L1 sgRNA
Plasmid#207563PurposepX330 expressing Cas9 and a sgRNA targeting the ATG16L1 locusDepositorInsertGCAGCAAGTGACATGTCGTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pG4
Plasmid#162605PurposeEdit Ade2 gene in yeastDepositorInsertTef1-Cas9 with RPL25 Intron
ExpressionYeastAvailable SinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P4 TaU6 guide acceptor
Plasmid#165600PurposeGoldenGate (MoClo) Level 1 Position 4 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Level 1 P3 TaU6 guide acceptor
Plasmid#165599PurposeGoldenGate (MoClo) Level 1 Position 3 TaU6 guide acceptor plasmidInsertTaU6 promoter::LacZ::sgRNA scaffold
UseCRISPR and Synthetic Biology; Sgrna acceptor with…Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-1
Plasmid#136046PurposeSMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only