We narrowed to 11,948 results for: 110
-
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_HA-spGFP11
Plasmid#240224PurposeGateway entry clone for cloning in insert sequences by gibson assembly to create a C-terminal HA-spGFP11 tag. No ATG start codon.DepositorTypeEmpty backboneUseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G42080-mKOk
Plasmid#224852PurposePlasmid for expression of AT5G40280.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G40280.1 (ERA1 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT4G33650-mKOk
Plasmid#224846PurposePlasmid for expression of AT4G33650.1 coding sequence tagged with mKOk in plantsDepositorInsertAT4G33650.1 (DRP3A Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3N
Plasmid#234614PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_3DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4N
Plasmid#234611PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to asparagineDepositorInserthnRNPA1_LCD_4DN (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214N, D242N, D250N, D262NPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -4D+4V
Plasmid#234610PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 4 aspartates mutated to valineDepositorInserthnRNPA1_LCD_4DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250V, D262VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3D+3V
Plasmid#234613PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 aspartates mutated to valineDepositorInserthnRNPA1_LCD_3DV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationD214V, D242V, D250VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRHA
Plasmid#232994PurposeGalactose iduced expression of Gcn4 SATtoG KtoRHAin yeastDepositorInsertGcn4 SATtoG KtoR
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoRGFP
Plasmid#233006PurposeGalactose iduced expression of Gcn4 SATtoG KtoRGFP in yeastDepositorInsertGcn4 SATtoG KtoR
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 SATtoG KtoR
Plasmid#231861PurposeBacterial expression of N-terminally 6His tagged Gcn4 SATtoG KtoRDepositorInsertGcn4 SATtoG KtoR
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
FAM177A1-Halo
Plasmid#224591PurposeFor expression of FAM177A1-Halo in mammalian cellsDepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_CAG-rtTA-T2A-mTagBFP2
Plasmid#229797PurposeBxb1-GA donor plasmid for constitutive expression of reverse tetracycline transactivator (rtTA) and nuclear mTagBFP2DepositorInsertrtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterCAGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-GA_AIO-TetOn_mScarlet_Up-Tandem
Plasmid#229793PurposeBxb1-GA donor plasmid with upstream tandem syntax for all-in-one doxycycline-inducible mScarlet expressionDepositorInsertTRE-mScarlet; rtTA-T2A-mTagBFP2
UseSynthetic BiologyTagsNLSExpressionMammalianPromoterTRE and CAGAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 ILVtoED solvvol
Plasmid#231858PurposeBacterial expression of N-terminally 6His tagged Gcn4 ILVtoED solvvolDepositorInsertGcn4 ILVtoED solvvol
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterT7Available SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S-FHA-SpAGO4a_gDNA
Plasmid#216841PurposeN-term Flag-HA tagged Spirodela polyrhiza (Sp9509) AGO4a gDNA under regulation of CaMV 35S promoterDepositorInsertARGONAUTE4
TagsFlag-HAExpressionPlantPromoterCaMV 35SAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only